ID: 960332773

View in Genome Browser
Species Human (GRCh38)
Location 3:116382708-116382730
Sequence TAAACATGACCTTAGATCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960332773 Original CRISPR TAAACATGACCTTAGATCAG AGG (reversed) Intronic
901919372 1:12525491-12525513 TCCACATGACCTCAGAGCAGAGG - Intergenic
905684572 1:39899706-39899728 TAAAAATGACCTTAACACAGTGG + Intronic
907165824 1:52409959-52409981 TAAACATTACCTTACTTCTGGGG - Intronic
908536723 1:65085120-65085142 TGTATATGACATTAGATCAGTGG - Intergenic
909357313 1:74724955-74724977 TAAACATGAAATGAGATCAGTGG - Intronic
909906634 1:81204081-81204103 GAAACATGACCCTAGATCCACGG + Intergenic
912601755 1:110942355-110942377 TAAAAATGACCTTAAAACATAGG - Intergenic
913590053 1:120315831-120315853 TAAAGAAGTCTTTAGATCAGAGG - Intergenic
913618132 1:120582535-120582557 TAAAGAAGTCTTTAGATCAGAGG + Intergenic
914418618 1:147507861-147507883 TAAAGATGAGCTTAGGTGAGGGG - Intergenic
914572081 1:148927688-148927710 TAAAGAAGTCTTTAGATCAGAGG - Intronic
914600754 1:149202577-149202599 TAAAGAAGTCTTTAGATCAGAGG + Intergenic
916344084 1:163768838-163768860 CAATCTTGAGCTTAGATCAGTGG - Intergenic
918529138 1:185498535-185498557 TAAACATGACAGTAGAAAAGGGG + Intergenic
920532027 1:206709558-206709580 TTAATATGACCTTAGATTTGTGG - Intronic
922749854 1:228065212-228065234 AAAAGATGACCTTGGCTCAGGGG + Intergenic
1067740748 10:48894613-48894635 CAAACATGTCCTGAGCTCAGGGG + Intronic
1074251878 10:111759088-111759110 TAGACATGACCTCAGAAAAGTGG + Intergenic
1076385906 10:130055551-130055573 TAAAAATGAGTTTAAATCAGTGG - Intergenic
1077990448 11:7405395-7405417 TAAACATTCCCTTCAATCAGTGG - Intronic
1079775067 11:24514917-24514939 TTTACATGACTTTAGGTCAGAGG + Intronic
1080285293 11:30604695-30604717 TAAACATTACCTAATGTCAGCGG - Intergenic
1081095293 11:38925269-38925291 TAGAGATGAAATTAGATCAGTGG - Intergenic
1081755377 11:45540631-45540653 TAAACATTCCCAAAGATCAGTGG - Intergenic
1082184716 11:49165093-49165115 AAAACATGACATTAGACCAGAGG - Intronic
1083230076 11:61311743-61311765 GAAAGATGACCTTAGAGCAGGGG - Intronic
1086681625 11:89680265-89680287 AAAACATGATATTAGACCAGAGG + Intergenic
1089801590 11:121034812-121034834 TTAACATGAACTTAGCTCAAAGG + Intronic
1093911786 12:24756341-24756363 TAAGCATTAAGTTAGATCAGAGG - Intergenic
1095474971 12:42577341-42577363 TAAACCAGACTTTTGATCAGGGG + Intronic
1098774194 12:74590347-74590369 TAAATATGACCTTAGAAAAGAGG + Intergenic
1099996977 12:89788669-89788691 AAAACAAGACCTGGGATCAGGGG - Intergenic
1100381469 12:94065562-94065584 TAAAGAAGACCTTAAATCACTGG + Intergenic
1102032767 12:109752583-109752605 ACAACATGACCTTGGATGAGTGG + Intronic
1115931141 14:38496528-38496550 TAAAGATGATCTGAGATCAAGGG + Intergenic
1121990569 14:98552918-98552940 TGAAAATGACCATGGATCAGGGG - Intergenic
1123132348 14:105999183-105999205 AAAACATTAACTTAGAACAGGGG - Intergenic
1123582565 15:21730296-21730318 AAAACATTAACTTAGAACAGGGG - Intergenic
1123619215 15:22172892-22172914 AAAACATTAACTTAGAACAGGGG - Intergenic
1126638289 15:50800753-50800775 TAGACATGCCCTTTGATCTGTGG - Intergenic
1126671664 15:51120946-51120968 TAAACAATACCTTAGAACAGTGG + Intergenic
1127004893 15:54557623-54557645 GAAAGATGACCTTAGACCAAAGG + Intronic
1130051160 15:80485099-80485121 TAAACACTACTATAGATCAGTGG + Intronic
1135053352 16:19210440-19210462 AAAAAATACCCTTAGATCAGAGG - Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136573427 16:31109790-31109812 TAGAGAGGACCTTAGGTCAGCGG + Intronic
1136863810 16:33723841-33723863 CAAACATGACTTAAAATCAGAGG + Intergenic
1137448391 16:48547367-48547389 GAAAAATGCCCTAAGATCAGTGG - Intronic
1147546734 17:41407784-41407806 TCAACATTAACTTAGGTCAGAGG - Intergenic
1148679367 17:49464914-49464936 GAAACAAGACTTTAGCTCAGTGG - Intronic
1150113862 17:62527179-62527201 CAAAAATGACCTTAGCTAAGCGG + Intronic
1156700768 18:39821626-39821648 TAAAAATGAACTTAGATGACTGG - Intergenic
1159589273 18:70314989-70315011 TATATATTACCTTAGATCAAAGG - Intronic
1160285836 18:77542412-77542434 TAAACATAACCTTACATGAAAGG - Intergenic
1164208862 19:23080345-23080367 TATACATGACACTAAATCAGTGG - Intronic
925840237 2:7985226-7985248 TCAACATGACCTAAGAGCAAGGG - Intergenic
928596718 2:32865924-32865946 GCCACATGACCTTAGATAAGTGG + Intergenic
931969503 2:67569953-67569975 TGAACATGTCATTAGATCATTGG - Intergenic
932824568 2:74927627-74927649 TCAACATTATCTTAGATTAGGGG - Intergenic
938800684 2:134760832-134760854 TAATGATCACCTTACATCAGTGG - Intergenic
938838569 2:135135279-135135301 TAAACAACACCTCAGATCTGGGG - Exonic
939142225 2:138368615-138368637 AGAACATGACCCAAGATCAGAGG + Intergenic
939617869 2:144380614-144380636 GAAACATGACATTGGATCAAAGG + Intergenic
939864162 2:147454168-147454190 AAAACATGCCTTTAGATCTGGGG - Intergenic
941379839 2:164779239-164779261 TAAATATTACCATAGATCACAGG + Intronic
942892059 2:181002267-181002289 TAAACATGAAACTAGATCAAAGG - Intronic
943089384 2:183356115-183356137 AAAAAAGGACCTTAAATCAGAGG - Intergenic
943673130 2:190686568-190686590 TAAACAAGACCTCAACTCAGAGG - Intronic
944508135 2:200436682-200436704 AAACAATGACCTTAGAGCAGAGG - Intronic
1175243931 20:57569965-57569987 GAAACTTTACCTTAGATCACTGG - Intergenic
1175634333 20:60568082-60568104 TTAACATGAGCTTAGATTTGTGG - Intergenic
1181316821 22:21976048-21976070 TAAAATTGACCTGAGATCACTGG - Intronic
1184432396 22:44449157-44449179 TGCACATGACCTCAGATGAGAGG + Intergenic
951168848 3:19514797-19514819 TTAACATGAATTTAGGTCAGAGG + Intronic
951801514 3:26601845-26601867 AAAACAGGACCCTTGATCAGAGG + Intergenic
957146377 3:76429746-76429768 TAAATATGACTATAAATCAGGGG + Intronic
958554165 3:95652793-95652815 TAACAATGACCATAGATCATAGG - Intergenic
958705574 3:97650209-97650231 TAAACATCAGCTTGGATCATAGG + Intronic
959828399 3:110830227-110830249 TAAACATAACCTTAGTTCCTGGG - Intergenic
960332773 3:116382708-116382730 TAAACATGACCTTAGATCAGAGG - Intronic
960667103 3:120120004-120120026 GAAACATTAGCTTAGAGCAGTGG - Intergenic
962416014 3:135182759-135182781 TGAACATGACCTTCCAGCAGTGG + Intronic
965030528 3:163359897-163359919 TAATCATGATCTTTGATCAGAGG - Intergenic
965030641 3:163361951-163361973 TAATCATGATCTTTCATCAGAGG - Intergenic
966374490 3:179281466-179281488 TAAATATGACCTTATCTAAGAGG - Intergenic
966389722 3:179439181-179439203 TAAATAAGAGCTTAGACCAGTGG - Intronic
967744423 3:193039265-193039287 TAAAAATGTTCTTAGATCTGTGG + Intergenic
969420154 4:7089523-7089545 AAAACATGACCTTAAAACACCGG - Intergenic
970001140 4:11367351-11367373 TAAACAACAGCTTAGATGAGAGG + Intergenic
974770764 4:66409424-66409446 AAAACATGACCTTAGATCCCAGG + Intergenic
975471105 4:74769310-74769332 CAAACATAACCTTAGACCAGGGG + Intronic
976671739 4:87661834-87661856 TAAAACTGACCGTAGATTAGAGG + Intronic
982550585 4:156793698-156793720 TAAACCTGACCTTAAAACAAAGG + Intronic
985282965 4:188305156-188305178 TAAAAATGTTCTTAGTTCAGAGG - Intergenic
987855835 5:23419651-23419673 TAAACATAACATTTGGTCAGAGG - Intergenic
987941673 5:24547072-24547094 TAACTATGAAATTAGATCAGTGG + Intronic
988911584 5:35848602-35848624 TAAACATGCCCTTAGCTACGGGG - Intergenic
989426699 5:41304031-41304053 TAAAAATTACCCAAGATCAGAGG - Intergenic
994458312 5:100043440-100043462 TAAACATCACTTTAGATCAAAGG - Intergenic
994490113 5:100430960-100430982 TAAACATGACCACAGATTTGGGG + Intergenic
995018142 5:107336005-107336027 TCCACATGAGCTTAGACCAGGGG + Intergenic
995992550 5:118260079-118260101 AAAACATAACCTTATATAAGAGG - Intergenic
1000986972 5:167871498-167871520 TAACCATGACCTTAAATATGGGG - Intronic
1007601842 6:43087057-43087079 GAAACATGACTTTAGAACAGAGG - Intronic
1008519176 6:52346544-52346566 CAAACAGGCCCTTAGATGAGAGG + Intergenic
1008746852 6:54682012-54682034 AAAGCAAGACCTTAGATAAGGGG - Intergenic
1010162930 6:72879808-72879830 TAAACATGATATTGGAACAGTGG - Intronic
1010458469 6:76085827-76085849 AAAACAAGACAGTAGATCAGGGG + Intergenic
1011883863 6:92066935-92066957 TAAAAATGTCTTTAGAGCAGTGG + Intergenic
1012573558 6:100762014-100762036 TACACATGAGCTCAGATCACAGG - Intronic
1014261108 6:119218289-119218311 TAAACATAATCTTAGGTGAGAGG - Intronic
1017189810 6:151640963-151640985 TAAGAATAAACTTAGATCAGTGG - Intergenic
1029866992 7:103643205-103643227 TAAAATTGACCTCAAATCAGTGG + Intronic
1033284695 7:140030900-140030922 TTCAGATTACCTTAGATCAGGGG - Intronic
1039219419 8:35312058-35312080 GAAACATGACTTTAGCTCTGAGG - Intronic
1041868137 8:62600319-62600341 TAATCATGAGCTTTGATCAGGGG + Intronic
1045943035 8:107760785-107760807 CAAACATTTCCTTAAATCAGTGG + Intergenic
1048588544 8:135799151-135799173 TTATCATGACCTTAGTTTAGTGG + Intergenic
1050465340 9:5917039-5917061 TAAACTAGACCTTAAATAAGAGG + Intronic
1051018859 9:12515993-12516015 TAAACACTACTTTAGTTCAGGGG - Intergenic
1053122451 9:35557158-35557180 TAAAAATGTTCTTAGTTCAGTGG - Intronic
1053450480 9:38189907-38189929 TAAAAAATACTTTAGATCAGGGG - Intergenic
1056983751 9:91341891-91341913 TTAAGATGACATTAGAGCAGAGG + Intronic
1058066604 9:100555258-100555280 TAAACAAGCCCTTAGCTAAGTGG - Intronic
1059612382 9:115912592-115912614 TAATCATCACATTGGATCAGAGG + Intergenic
1186941986 X:14519417-14519439 TAAACATGACATTAGAATAATGG - Intergenic
1188456912 X:30377442-30377464 TACACTTGACCTTAGCCCAGAGG - Intergenic
1191156628 X:57281515-57281537 AAAACATGAACTTATATCTGAGG - Intergenic
1194393869 X:93355277-93355299 TAATAATGACCTTAGACCATTGG - Intergenic
1195247970 X:103013665-103013687 TAAACATGAGCTTATACCATAGG + Intergenic
1195281716 X:103341462-103341484 TACAGATAAACTTAGATCAGTGG + Intergenic
1197889363 X:131252524-131252546 TAAATATGACCTAATATGAGAGG - Intergenic
1198582083 X:138076525-138076547 TAAAAAATAACTTAGATCAGAGG + Intergenic
1199372749 X:147070466-147070488 AAAACATGACAGTAGATCATAGG - Intergenic
1199791785 X:151161744-151161766 TAAACCTTACCTTAAATCAGAGG - Intergenic