ID: 960333882

View in Genome Browser
Species Human (GRCh38)
Location 3:116392840-116392862
Sequence CGGGATGACAAGCTACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 1, 2: 18, 3: 136, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960333874_960333882 28 Left 960333874 3:116392789-116392811 CCAGGACTCAGCCAGACTTGAGC 0: 4
1: 15
2: 60
3: 152
4: 391
Right 960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG 0: 1
1: 1
2: 18
3: 136
4: 353
960333873_960333882 29 Left 960333873 3:116392788-116392810 CCCAGGACTCAGCCAGACTTGAG 0: 2
1: 6
2: 33
3: 109
4: 351
Right 960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG 0: 1
1: 1
2: 18
3: 136
4: 353
960333876_960333882 17 Left 960333876 3:116392800-116392822 CCAGACTTGAGCAGAGGATAGAG 0: 1
1: 0
2: 1
3: 17
4: 163
Right 960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG 0: 1
1: 1
2: 18
3: 136
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960333882 Original CRISPR CGGGATGACAAGCTACAGAG AGG Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
902644726 1:17790495-17790517 CGGGACAACAGGCTGCAGAGAGG - Intronic
903101774 1:21035970-21035992 CAGGATGACCAGCTGTAGAGAGG + Intronic
903311867 1:22465331-22465353 TGGGATGACTAGCTACAGAGAGG - Intronic
904365709 1:30009905-30009927 TGGGATGACCAGCTGCAGAGGGG - Intergenic
904370118 1:30042904-30042926 TGGGATGACCAGCTGCAGACAGG + Intergenic
904577391 1:31513900-31513922 TGGGATGACTAGCAGCAGAGAGG - Intergenic
905001313 1:34671882-34671904 TGGGATGACCAACTTCAGAGAGG + Intergenic
905001326 1:34672007-34672029 CAGGATGACTGGCTGCAGAGAGG + Intergenic
905001336 1:34672075-34672097 TGGGATGACCACCTGCAGAGAGG + Intergenic
905001350 1:34672151-34672173 AAGGATGACCAGCTGCAGAGAGG + Intergenic
905841996 1:41189055-41189077 TGGAAGGACAAGCTACAGGGAGG + Intronic
906854795 1:49292552-49292574 GGGGATGACTAGCTGCAGAGAGG + Intronic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
907777826 1:57536032-57536054 CGGGAAGGCAAACCACAGAGTGG - Intronic
907966522 1:59335938-59335960 CGAAAAGACAAGCTACAGACTGG - Intronic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
909282340 1:73771036-73771058 TGGGATAACCAGCTGCAGAGAGG + Intergenic
910654915 1:89609776-89609798 TGGGATGACCAGCTGCAGAGAGG - Intergenic
910654925 1:89609846-89609868 TGGGATGACCCGCTACAGAGAGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911025053 1:93427149-93427171 TGGGACGACCAGCTGCAGAGAGG + Intergenic
911275582 1:95853909-95853931 TGGGATGACCAGCTGCAGAGAGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
914722700 1:150302335-150302357 CGGGATGAGAAGGTGGAGAGTGG + Intronic
915185065 1:154098530-154098552 TGGGATGACCAGCAGCAGAGAGG - Intronic
916648807 1:166816438-166816460 CAAGATGACCAGCTGCAGAGAGG - Intergenic
919083224 1:192891301-192891323 TGGGATGATCAGCTGCAGAGAGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922132774 1:222795661-222795683 TGGGATGAACAGCTGCAGAGAGG + Intergenic
923347924 1:233074629-233074651 CGAAAAGACAAGCTACAGACTGG + Intronic
924412086 1:243817065-243817087 CAGGATGACCTGCTAGAGAGAGG + Intronic
924679946 1:246220998-246221020 TGGGACGACCAGCTGCAGAGAGG + Intronic
1062778151 10:173340-173362 TGTGATGACAGGCTACAGACTGG + Intronic
1063025103 10:2170387-2170409 GGGGAAGACAAGAAACAGAGGGG - Intergenic
1067018069 10:42772252-42772274 CAGGACAACTAGCTACAGAGAGG + Intergenic
1067319143 10:45200536-45200558 AGGGAAGACAAGCCACAGACTGG - Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068060575 10:52063806-52063828 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068060585 10:52063874-52063896 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068083614 10:52347846-52347868 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068348499 10:55814011-55814033 CGGGATGCCCAGCTGCAGAATGG + Intergenic
1069154248 10:65005566-65005588 TGAGAAGACAAGCCACAGAGTGG - Intergenic
1069156301 10:65034876-65034898 TGGGATGACCAGGTACAGAGAGG + Intergenic
1070859327 10:79638163-79638185 TGGGACGACCAGCTGCAGAGAGG - Intergenic
1071060863 10:81570197-81570219 TGGGATGACCAGCTGCAGAAAGG - Intergenic
1071957112 10:90771082-90771104 CGGGATGACCAGCTGCAGACAGG + Intronic
1072335525 10:94395094-94395116 CAAGATGACCAGCTTCAGAGAGG - Intergenic
1072449069 10:95524888-95524910 CTTGATGACAAGCTAGAGAAGGG + Intronic
1072753363 10:97999965-97999987 TGGAATGACCAGCTGCAGAGAGG + Intronic
1073733609 10:106320476-106320498 CAGGACAACCAGCTACAGAGAGG + Intergenic
1074028794 10:109663913-109663935 TGGGATGACCAGCTACAGAGAGG + Intergenic
1074247910 10:111713477-111713499 CAGGATGACCAGCTCCAGAGAGG - Intergenic
1074247921 10:111713591-111713613 TGGGATGACCAGCTGTAGAGAGG - Intergenic
1074991512 10:118712684-118712706 TGGGACGACCAGCTGCAGAGAGG - Intronic
1074991520 10:118712754-118712776 TGAGATGACCAGCTGCAGAGAGG - Intronic
1075007827 10:118842996-118843018 TGGGATGACCAGCTGCAGGGAGG + Intergenic
1075007837 10:118843066-118843088 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1076549116 10:131266785-131266807 AGGGACGACCAGCCACAGAGAGG - Intronic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076655119 10:132018974-132018996 TGGGATGAGCAGTTACAGAGAGG - Intergenic
1077012835 11:386427-386449 CGGGATGACCAGCTGCAGAAAGG + Intergenic
1077844674 11:6012385-6012407 TGGGATGACCAGGTGCAGAGAGG - Intergenic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078042755 11:7883909-7883931 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1078315127 11:10288486-10288508 TGGGATGACCAGCTGCAGAGAGG - Intronic
1079293751 11:19212853-19212875 TGGGAAGACAAGCCACAGACTGG - Intergenic
1079710672 11:23679698-23679720 AGGGATGACCAGCTGCGGAGAGG - Intergenic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1084991165 11:72926431-72926453 TGGGATGGCCAGCTGCAGAGAGG + Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1087715963 11:101609177-101609199 TGGGATAACAAAATACAGAGTGG - Intronic
1088135691 11:106552887-106552909 CAGGATGACCAGCTGCGGAGAGG + Intergenic
1089234800 11:117014527-117014549 GGAAAAGACAAGCTACAGAGGGG + Intronic
1089352299 11:117828534-117828556 GGGGATGCCTAGCTACAGACCGG - Intronic
1089670060 11:120049891-120049913 TGAAAAGACAAGCTACAGAGTGG + Intergenic
1089823201 11:121246798-121246820 TGGGATGACCCGCTGCAGAGAGG + Intergenic
1090124869 11:124075343-124075365 TGGGATGACCTGCTGCAGAGAGG - Intergenic
1090137010 11:124209581-124209603 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092501432 12:9051264-9051286 CGGGATTACCAGCTGCAGAGAGG + Intergenic
1092501450 12:9051393-9051415 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1092787821 12:12045034-12045056 TGAAAAGACAAGCTACAGAGTGG + Intergenic
1093281833 12:17204343-17204365 TGGGATGACCAGCTACAGAGGGG + Intergenic
1094018115 12:25885136-25885158 CGGGATTACCAGCTGCAGAAAGG + Intergenic
1094144506 12:27214421-27214443 CAGGAGGACTAGCTGCAGAGAGG + Intergenic
1094374913 12:29779732-29779754 CAAAAAGACAAGCTACAGAGTGG + Intronic
1095826131 12:46531615-46531637 CAGGATGACCATCTGCAGAGAGG + Intergenic
1096602150 12:52736967-52736989 CAGGACGACGAGCTGCAGAGAGG - Intergenic
1096602901 12:52742712-52742734 AGGGAGGACCAGCTGCAGAGAGG + Intergenic
1096602907 12:52742766-52742788 CAGGACGACGAGCTGCAGAGAGG + Intergenic
1097130857 12:56809953-56809975 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1097140660 12:56900172-56900194 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1097298971 12:57998031-57998053 CAGGAGGACCAGCTTCAGAGTGG - Intergenic
1098465598 12:70783370-70783392 TGGGACTACCAGCTACAGAGAGG - Intronic
1098465606 12:70783433-70783455 CAGAATGATCAGCTACAGAGAGG - Intronic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1101457380 12:104849247-104849269 TGGAAAGACAAGCCACAGAGTGG + Intronic
1101463295 12:104919764-104919786 TGAAAAGACAAGCTACAGAGTGG - Intronic
1101756517 12:107625270-107625292 TGAAAAGACAAGCTACAGAGTGG - Intronic
1102060451 12:109926990-109927012 CGGGACAACCAGCTGCAGAGAGG + Intronic
1104522790 12:129490875-129490897 CTGGATGTGAAGCTACAGGGAGG - Intronic
1104534611 12:129607371-129607393 CTGCATGCCAAGCTCCAGAGGGG - Intronic
1104897629 12:132172113-132172135 CGGGATCACTGGCTCCAGAGGGG - Intergenic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106816456 13:33413537-33413559 AAGGATGAAAAGCTACAGAGAGG + Intergenic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107450070 13:40500310-40500332 CGAGATAACAAGCGGCAGAGGGG + Intergenic
1107740136 13:43441730-43441752 TGGGATCACAACATACAGAGCGG - Intronic
1107847387 13:44530573-44530595 CGAGAAGACAAGCCACAGATTGG + Intronic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1111512646 13:89287156-89287178 TGGGATGAGCAGCTGCAGAGAGG - Intergenic
1111523748 13:89439940-89439962 TGGAAAGACAAGCTACAGAGTGG + Intergenic
1113970723 13:114186190-114186212 CAGGATGACCAGCTACAGAGGGG + Intergenic
1115024133 14:28720478-28720500 TGAGATGACAAGCCACAGACTGG + Intergenic
1115715516 14:36098838-36098860 AGGGAGGAGAAGCAACAGAGAGG + Intergenic
1116257247 14:42571514-42571536 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1117505034 14:56393511-56393533 TGAGAAGACAAGCTACAGACTGG + Intergenic
1117713347 14:58555399-58555421 CTTGATGAAAAGCTACAGATGGG - Intergenic
1118200077 14:63663507-63663529 CAGGATGACCAGCTATGGAGAGG - Intergenic
1118410063 14:65469762-65469784 CCAGATGACTAGCTGCAGAGAGG - Intronic
1118946990 14:70398115-70398137 TGGGATGACCAGCTCCAGAGAGG - Intronic
1119415893 14:74468914-74468936 AGGGAAGACAAGATACAGTGAGG - Intergenic
1120405744 14:84091464-84091486 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1120981391 14:90292399-90292421 CTGGAAGACAATCTCCAGAGGGG + Intronic
1121247941 14:92476339-92476361 AGGGACTACAAGCTACAGAAAGG + Intronic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1121974083 14:98386043-98386065 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1121974089 14:98386096-98386118 TGGGACAACCAGCTACAGAGAGG + Intergenic
1122710987 14:103658011-103658033 ATGGAAGCCAAGCTACAGAGGGG - Intronic
1124650206 15:31468890-31468912 TGGGATGACCAACTGCAGAGAGG - Intergenic
1124820893 15:33044635-33044657 GAGGATGACCAGCTGCAGAGAGG + Intronic
1125381551 15:39092188-39092210 TGGGATTACCAGCTGCAGAGAGG - Intergenic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125436081 15:39646169-39646191 TGGGAAGACCAGCTGCAGAGAGG + Intronic
1125752398 15:42037370-42037392 CAGGATGACCAGCTGCTGAGAGG + Intronic
1127404328 15:58625211-58625233 CGAAAAGACAAGCTACAGACTGG + Intronic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128847887 15:70917506-70917528 TGGGATGACCATCTGCAGAGAGG + Intronic
1129154769 15:73710928-73710950 GAGAATGACAAGCCACAGAGTGG + Intronic
1129377704 15:75144677-75144699 CATGATGACCAGCTGCAGAGAGG - Intergenic
1130028966 15:80295012-80295034 TAGGATGACCAGCTGCAGAGAGG - Intergenic
1135433709 16:22410029-22410051 CGAGAAGACAAGCCACAGATGGG - Intronic
1135962444 16:27008608-27008630 TGAAATGACAAGCTACAGACTGG + Intergenic
1136030966 16:27502727-27502749 CGAGATGAGAATCTACACAGTGG + Intronic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1137233665 16:46594297-46594319 TGAAAAGACAAGCTACAGAGTGG + Intronic
1137238221 16:46633158-46633180 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138033501 16:53579920-53579942 CAGAATGACCAGCTACAGAGAGG - Intergenic
1138033513 16:53579988-53580010 TGGGATGACCAGCTACAGAGAGG - Intergenic
1139389981 16:66601416-66601438 TGGGAGGACCAGGTACAGAGAGG - Intergenic
1141254263 16:82386116-82386138 AGTGATTACAAGGTACAGAGTGG - Intergenic
1141474218 16:84261508-84261530 AAGGATGCCAAGCTGCAGAGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1142484269 17:236580-236602 AGGGCTGGCAAGCTGCAGAGCGG + Intronic
1142492907 17:290145-290167 CGGGAAGACAAGCTGCACGGAGG + Intronic
1142682872 17:1560813-1560835 CTGGATGTCAAGAAACAGAGGGG + Intronic
1144060899 17:11582873-11582895 CAGGATGACCAGCTACAGAGAGG - Intergenic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1148386252 17:47237256-47237278 GGAGATGACCAGCTGCAGAGAGG - Intergenic
1148386269 17:47237336-47237358 GGTGATGACCAGCTGCAGAGAGG - Intergenic
1149085491 17:52710421-52710443 CTGGAGGACATGCTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1150951000 17:69802013-69802035 CAGGATGACCAGCTACAGAGAGG + Intergenic
1150951010 17:69802083-69802105 TGGGATGACCAGCTGGAGAGAGG + Intergenic
1151395267 17:73819193-73819215 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1151624743 17:75269949-75269971 CTGGAAGACAAGCTACATTGAGG - Intronic
1152530403 17:80915179-80915201 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530430 17:80915387-80915409 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530439 17:80915457-80915479 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530470 17:80915667-80915689 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530502 17:80915877-80915899 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155120660 18:22816187-22816209 TGGGATGACCAGTTGCAGAGAGG - Intronic
1155830854 18:30513630-30513652 AGGGATGACCTGCTACAGAGAGG - Intergenic
1156160386 18:34351308-34351330 TGGGAGGACCAGCTTCAGAGAGG + Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1158218205 18:55122325-55122347 CAGTATGGCAAGGTACAGAGTGG + Intergenic
1159184763 18:64955270-64955292 CGGGGAGAAAAGCTACAAAGGGG + Intergenic
1159795646 18:72840012-72840034 CTATAAGACAAGCTACAGAGAGG - Intronic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1161173185 19:2823714-2823736 CCGGACGACCAGCTGCAGAGAGG - Intronic
1161780214 19:6286707-6286729 CGGGACTACCAGCTGCAGAGAGG + Intergenic
1161781849 19:6298114-6298136 CATGACGACTAGCTACAGAGAGG + Intergenic
1164944244 19:32279579-32279601 TGGGAAGACAAGCCACAGACTGG + Intergenic
1165022656 19:32936643-32936665 TGAGATGACCAGCTGCAGAGAGG + Intronic
1165026920 19:32969155-32969177 TGGGGTGACCAGCTACAGAGAGG - Intronic
1166007635 19:39918103-39918125 CGAGATGCCAAGCTCCAGACAGG + Exonic
1166897518 19:46033114-46033136 TGGGATGACCAGCTCCAGGGAGG + Intergenic
1167346275 19:48947351-48947373 CAGGATGACCAGCTACAGAGCGG + Intergenic
924963907 2:58157-58179 TGGGATGACCAGCTGCAGGGAGG + Intergenic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925048225 2:790390-790412 TGGGATGACCTGCCACAGAGAGG + Intergenic
926268687 2:11348132-11348154 CTGAATGACAAGCAACAGACTGG - Intronic
926953637 2:18271394-18271416 CGGGAGGACCAGTTGCAGAGAGG - Intronic
927072942 2:19548717-19548739 TGGGATGACCAGCTGCAGAAAGG + Intergenic
927226228 2:20767956-20767978 TGGGATGACCAGCTGCAGAGAGG + Intronic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927613538 2:24566298-24566320 TGGGATGACCAGCTGCGGAGAGG - Intronic
928109782 2:28497235-28497257 TAGGAGGACAAGCTTCAGAGTGG - Intronic
928809096 2:35199759-35199781 CGAAAGGACAAGCCACAGAGTGG - Intergenic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
930612046 2:53554404-53554426 TGGGATGACCAGCTGCAAAGAGG + Intronic
930612060 2:53554518-53554540 TGGGATGACCAGCTGCAGAAAGG + Intronic
930800595 2:55438725-55438747 TGGAATGACCAGCTACAGAGAGG + Intergenic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
933093325 2:78146924-78146946 TGGGATGACTAGCTGCAGAGAGG + Intergenic
933624672 2:84585624-84585646 CGGGAAAACCAGCTGCAGAGGGG - Intronic
933801123 2:85961227-85961249 CAGGATGACCAGCTGCAGAAAGG - Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
934855632 2:97727746-97727768 GGGGATGAAAAGCTACATTGGGG - Intronic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
937228491 2:120383471-120383493 CGGGAGGACGCGCTACACAGTGG - Intergenic
937436158 2:121883261-121883283 CGGGATGAAAAACTACTAAGAGG - Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
938180631 2:129179088-129179110 CAGGATGACCAGCTTCAGAGGGG - Intergenic
938209299 2:129453409-129453431 TGAAAAGACAAGCTACAGAGTGG + Intergenic
938342877 2:130547133-130547155 CAGGATGAGAAGCCTCAGAGTGG + Intronic
938346956 2:130573589-130573611 CAGGATGAGAAGCCTCAGAGTGG - Intronic
939173915 2:138727701-138727723 GGAGAAGACAAGCTACAGACTGG - Intronic
941023026 2:160430025-160430047 CAGAATGAGAAGCTACACAGAGG + Intronic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
942253236 2:174065513-174065535 TGAGAAGACAAGCTACAGACTGG - Intergenic
942747349 2:179250075-179250097 TGAAAAGACAAGCTACAGAGTGG + Intronic
942916160 2:181309842-181309864 AGAGAAGACAAGCTACAGAGAGG + Intergenic
943820374 2:192314510-192314532 TGGAATGACCAGCTACATAGAGG - Intergenic
943961236 2:194265342-194265364 TGGGATGACAAGCTGCAGAGAGG + Intergenic
944586696 2:201179105-201179127 TGGGATGACCAGCTGCAGAGAGG + Intergenic
944870391 2:203905531-203905553 TGAGATGACAAGCCACAGACTGG + Intergenic
944901792 2:204223360-204223382 CGGGACGACCGGCTGCAGAGAGG - Intergenic
945330092 2:208529633-208529655 TGGAATGACCAGCTACAGAGAGG - Intronic
945330099 2:208529701-208529723 CAGGATGACTAGCTTCAAAGAGG - Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946197422 2:218043503-218043525 TGGGTTGACCAGCTGCAGAGAGG - Intronic
946422905 2:219575026-219575048 CGGGCTGAGCAGGTACAGAGGGG - Exonic
947327241 2:228992322-228992344 TGGGATGATCAGCTACAGAGAGG - Intronic
947847211 2:233254284-233254306 CGGGATGAGAAGCTAACAAGAGG + Intronic
948161957 2:235832245-235832267 CGAGAAGACAAGCTACAGACTGG - Intronic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
1170495046 20:16915732-16915754 CTGGACAACCAGCTACAGAGAGG + Intergenic
1171018886 20:21566164-21566186 CGAGAAGGCAAGCCACAGAGTGG - Intergenic
1171236875 20:23534690-23534712 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1171242547 20:23583347-23583369 TGGAAAGACAAACTACAGAGTGG - Intergenic
1173524435 20:43721289-43721311 AGGGATGACCAGCTGCAGAGAGG - Intergenic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175065136 20:56277706-56277728 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1176976528 21:15327309-15327331 CAGGACAACAAGCTGCAGAGAGG + Intergenic
1176976543 21:15327434-15327456 TGGGATGATCAGCTGCAGAGAGG + Intergenic
1177396067 21:20537985-20538007 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1178467051 21:32858568-32858590 CAGGATGACCAGCTGTAGAGAGG - Intergenic
1179431264 21:41322831-41322853 CGGGATGAAAAGCCACAGGGGGG + Intronic
1179683945 21:43042861-43042883 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1181412707 22:22735264-22735286 CTGGATGAGAAACCACAGAGCGG - Intronic
1181416043 22:22759386-22759408 CTGGATGAGAAACCACAGAGCGG - Intronic
1182394432 22:30025242-30025264 TGTGATCACAAGCTACACAGAGG + Intronic
1183491623 22:38119959-38119981 CAGAAAGACAAGCCACAGAGTGG + Intronic
1184054239 22:42033759-42033781 TGGGACGACCAGCTGCAGAGAGG - Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184613632 22:45622671-45622693 CAGGATGACCAGTTACAGAGAGG + Intergenic
1184916402 22:47571875-47571897 AGGGATGACAAGAGACAGAGTGG + Intergenic
1185293747 22:50042201-50042223 TGGGAAGACAAGCCACAGACTGG + Intronic
950431741 3:12954868-12954890 CAGGATGGAAAGCCACAGAGCGG + Intronic
951136193 3:19107114-19107136 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951562431 3:23982063-23982085 AGGGATGACCAGCTGCAGAGAGG - Intergenic
951718440 3:25673727-25673749 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951969091 3:28423140-28423162 TAAGATGACAAGCCACAGAGTGG - Intronic
952016162 3:28959340-28959362 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
952269336 3:31816959-31816981 TGGGATGATGAGCTGCAGAGTGG - Intronic
952473296 3:33679439-33679461 TGAGAAGACAAGCCACAGAGTGG + Intronic
952793372 3:37217822-37217844 TGGGACGACTAGCTGCAGAGAGG + Intergenic
953177643 3:40566464-40566486 GGGGATCACAAGGTACTGAGTGG - Intronic
954099334 3:48357515-48357537 CAGGATGACTAGCTGCAGATTGG - Intergenic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954498065 3:50983484-50983506 TGGGATGACCAGTTGCAGAGAGG + Intronic
954650864 3:52162091-52162113 TGGGATGATCAGCTACAGAGAGG - Intergenic
955241490 3:57182578-57182600 AGGAATGACCAGCTGCAGAGAGG - Intergenic
956214519 3:66834672-66834694 TGGGAAGACAAGCTATAGATTGG - Intergenic
957400403 3:79705118-79705140 CGAGTAGACAAGCCACAGAGTGG - Intronic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
958119081 3:89261552-89261574 CTGGGTGACAGGCTACAGTGGGG - Intronic
958164929 3:89868434-89868456 TGAGCTGACAAGCTACAGAATGG + Intergenic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
959375502 3:105584215-105584237 CGGGGATACAAGCTGCAGAGTGG + Intergenic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
960690624 3:120342406-120342428 TGGGGTGACCAGCTGCAGAGAGG + Intronic
962803205 3:138908030-138908052 TGAGATGACAAGCCACAGACTGG - Intergenic
962824500 3:139088269-139088291 TGGGATGACCAGCAGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963454232 3:145523006-145523028 TGTGATGACAAGCTGCAGAGAGG - Intergenic
963805187 3:149714920-149714942 GGTGATGACCAGCTGCAGAGAGG + Intronic
963805195 3:149714957-149714979 TGGGAGGACTAGCTGCAGAGAGG + Intronic
964255018 3:154766335-154766357 TGGGATGACCAGCAGCAGAGGGG - Intergenic
965309863 3:167115424-167115446 GGGGAGGACAAGCTGCAGAGAGG - Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
967363717 3:188661719-188661741 TGAGAAGACAAGCCACAGAGTGG - Intronic
968472390 4:788087-788109 CGGGATCACCAGCCACAGGGAGG + Intronic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
971938779 4:33188547-33188569 TGGGATGACTAGCTGCAGAGAGG - Intergenic
972931029 4:44071908-44071930 TGGGAAGACCAGCTGCAGAGAGG - Intergenic
974972976 4:68853897-68853919 CGGGACAACAAGCTGCAGAGAGG - Intergenic
975321365 4:73012334-73012356 AGGGATGACCAACTGCAGAGAGG + Intergenic
975597759 4:76066568-76066590 TGGGATGACCAGCAGCAGAGAGG - Intronic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976775997 4:88706794-88706816 CTGGATGACAATCTGCAGACTGG - Exonic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
978229865 4:106385594-106385616 TGGGATAACCAGCTGCAGAGAGG - Intergenic
978249293 4:106610743-106610765 TGGGATGACCAGCTGCAGAGAGG + Intergenic
979145405 4:117240172-117240194 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
979448179 4:120839492-120839514 TGGAATGACCAGCTGCAGAGAGG - Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
980007624 4:127559582-127559604 TGGGGTGACCAGCTGCAGAGAGG + Intergenic
980278731 4:130690267-130690289 TGAGATGACAAGCTACAGACTGG - Intergenic
980306239 4:131064787-131064809 TGGGATGATCAGCTGCAGAGAGG - Intergenic
980750028 4:137076744-137076766 CGAGATGACTGCCTACAGAGAGG - Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
983491929 4:168398795-168398817 CAGGATTACCAGCTACGGAGGGG + Intronic
983784597 4:171715696-171715718 CGAGATGACCAGCTGCAGAGAGG + Intergenic
984868009 4:184299691-184299713 CGAGATGACAAGCGACAGCGAGG + Intergenic
986617382 5:9632483-9632505 CAGCATCACATGCTACAGAGAGG - Intronic
986794365 5:11194271-11194293 TGGGAAGACAAGCTAGAAAGGGG + Intronic
987798886 5:22667280-22667302 CGGGACAACCAGCTGCAGAGAGG - Intronic
987999627 5:25331340-25331362 TGGGATGACCAGCTGCAGAAAGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988446142 5:31288000-31288022 GGGGATGGCAAGCCACAAAGTGG - Intronic
989279136 5:39621603-39621625 AGGGATGACCAGCTGCAGAGAGG - Intergenic
989279149 5:39621717-39621739 TGGGATGGCCAGCTGCAGAGAGG - Intergenic
989520696 5:42396773-42396795 CGGGATGACCAGCTACAGAGAGG + Intergenic
990023769 5:51160188-51160210 CAGGAGGACCAGCTAGAGAGAGG + Intergenic
990894116 5:60678831-60678853 TGAGAGGACAAGCTACAGATGGG - Intronic
990923450 5:60993702-60993724 CGGGGTGATCAGCTGCAGAGAGG - Intronic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991107599 5:62861943-62861965 AGGGATGACCAGCTGCAGAGAGG - Intergenic
994449922 5:99929317-99929339 TGGGATGACCAGCCGCAGAGGGG - Intergenic
994641030 5:102410241-102410263 GGGGATGACCAGTTGCAGAGAGG - Intronic
994641037 5:102410295-102410317 AAGGATGACCAGCTACAGAGAGG - Intronic
994677499 5:102843562-102843584 TGTAAAGACAAGCTACAGAGTGG + Intronic
994790791 5:104223817-104223839 TGGGATGACCAGCTGCAGAGAGG - Intergenic
995742446 5:115369012-115369034 GAGGATGACCAGCTGCAGAGAGG + Intergenic
996360772 5:122643297-122643319 TGAGAAGACAAGCCACAGAGTGG + Intergenic
999859951 5:155634040-155634062 TGGGATGACCAGCCGCAGAGAGG + Intergenic
1001397522 5:171427947-171427969 AGGAATGATAAGCCACAGAGAGG - Intronic
1001936386 5:175708814-175708836 CTTGATGACAAGCACCAGAGAGG - Intergenic
1002072385 5:176688001-176688023 TGGGATGACTAGCAGCAGAGAGG - Intergenic
1002689074 5:181037709-181037731 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1002802886 6:543000-543022 CTGGATGATAAGCTGGAGAGTGG + Intronic
1002986265 6:2192205-2192227 TGGGATGACCAGCTGCAGAGAGG + Intronic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004304515 6:14487803-14487825 CGGGACGACCAGCTGCAGAGAGG + Intergenic
1004304541 6:14487972-14487994 CAGGAAGACCAGCTACAGGGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1004801047 6:19148436-19148458 TGGTAAGGCAAGCTACAGAGAGG - Intergenic
1005021433 6:21423172-21423194 AAGGATGACTAGCTGCAGAGAGG - Intergenic
1005043451 6:21620309-21620331 TAGGATGACCAGCTACAGAGAGG - Intergenic
1005279326 6:24255500-24255522 AGTGATGACAAGCCACAGAATGG + Intronic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006867578 6:37221978-37222000 TGGGAGGACCAGCTACAGAGAGG - Intronic
1008188289 6:48422764-48422786 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1009610138 6:65930903-65930925 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1009846878 6:69145845-69145867 CGGGATGAACAGCTGCAGAGAGG - Intronic
1010884068 6:81215349-81215371 CGGGATGACCAGCTGCAGGGAGG + Intergenic
1011530133 6:88312477-88312499 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1012052248 6:94361191-94361213 CAGGATGACCAGCTGCAGACAGG - Intergenic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1012332159 6:98005856-98005878 TGGGAAGACAAGCTACAGACTGG - Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1013375554 6:109510298-109510320 CAGGATGACCAGCTGCAGAAAGG + Intronic
1013693130 6:112668350-112668372 TGGGATGACCAGTTACAGAGAGG + Intergenic
1014289307 6:119539897-119539919 TGGGATGACCAACTACAGAGAGG + Intergenic
1015143326 6:129959007-129959029 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1015663766 6:135604051-135604073 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1016533987 6:145090620-145090642 TGGGATGGGGAGCTACAGAGGGG + Intergenic
1016719456 6:147278086-147278108 CATGATGCCAAGCAACAGAGTGG - Exonic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018659933 6:166076640-166076662 GGGAATGACCAGCTGCAGAGAGG - Intergenic
1020743066 7:12046592-12046614 TGGGATGATTAGCAACAGAGGGG + Intergenic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1021500746 7:21329872-21329894 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1021540358 7:21750711-21750733 CAGGATGACCAGCTCCAGTGAGG - Intronic
1021561366 7:21971899-21971921 TGGGATGACCAGCTACAGAGAGG - Intergenic
1022332716 7:29395744-29395766 GGGGATGACAAGCCACAGACTGG + Intronic
1023463442 7:40426484-40426506 CAGGAAGAGAAGCTACATAGAGG + Intronic
1023693053 7:42812041-42812063 AGGGATGAAAAGCTACACACTGG + Intergenic
1023789159 7:43737931-43737953 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1023790406 7:43749467-43749489 CGGGACTACCAGCTGCAGAGAGG - Intergenic
1027128375 7:75573194-75573216 TGGGACGACCAGCTACAGAGAGG + Intronic
1027779814 7:82507467-82507489 CAAGATGACCAGCAACAGAGAGG - Intergenic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029704385 7:102268375-102268397 GGGGGTCAGAAGCTACAGAGAGG - Intronic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1030096077 7:105901089-105901111 TGAGAAGACAAGCTACAGACTGG - Intronic
1030538312 7:110796299-110796321 CTGGATGCCAAGCTTCAGAGAGG + Intronic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1032658296 7:133955353-133955375 CGGGACAACCAGCTGCAGAGAGG - Intronic
1034255344 7:149721744-149721766 CGGGATGACAGGCTCCCCAGGGG - Intronic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1034481251 7:151321581-151321603 TGGGATGACCAGCTGCAAAGAGG + Intergenic
1034481262 7:151321651-151321673 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1035252366 7:157605727-157605749 GGGGATGACCAGCTGCAGAGAGG - Intronic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1035451018 7:158976754-158976776 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1035612409 8:976988-977010 TGAAATGACAAGCTACAGACTGG + Intergenic
1035882835 8:3260851-3260873 TGGAAAGACAAGCTACAGACTGG + Intronic
1037369576 8:18161502-18161524 CAAAAAGACAAGCTACAGAGTGG + Intergenic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1038905017 8:31891204-31891226 TGGAAAGACAAGCTACAGATTGG + Intronic
1039182293 8:34880328-34880350 TGGGTTGACCAGCTGCAGAGAGG - Intergenic
1040661886 8:49583484-49583506 TGGGAGGACCAGCTACAGAGAGG + Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1041502128 8:58550605-58550627 TGAGAAGACAAGCTACAGACTGG - Intergenic
1042196795 8:66238008-66238030 CAGGATGACCAGCTGCAGAAAGG - Intergenic
1043087146 8:75849332-75849354 CAGGATGACCAGGTACAGAGAGG - Intergenic
1043388471 8:79769245-79769267 CAGGACTACAAGCTTCAGAGTGG - Intergenic
1043568073 8:81570591-81570613 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1043745594 8:83869785-83869807 TGGGATGACCAGCTGCAGTGAGG + Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1046395238 8:113632579-113632601 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1048421670 8:134283884-134283906 TGGGATGATCAGCTTCAGAGAGG - Intergenic
1048726717 8:137393954-137393976 TGAGATGACAAGCCACAGACAGG - Intergenic
1049824044 8:144655471-144655493 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050725522 9:8644141-8644163 TGGGATGACCAGCTGCAGAGAGG + Intronic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052704817 9:31981945-31981967 GGGGATGGCAAGCTACAGAGTGG + Intergenic
1052707600 9:32011336-32011358 CGGGATGACCAGCTGCAGACAGG + Intergenic
1053150390 9:35739473-35739495 CTAGAGGACAAGCTACAGAGGGG - Intronic
1055879655 9:80985013-80985035 TGAGAAGACAAGCTACAGACTGG - Intergenic
1056192011 9:84194286-84194308 CAGGACCACCAGCTACAGAGAGG - Intergenic
1056879716 9:90379665-90379687 CAGGATGACATGCTGCAGGGGGG - Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1058091970 9:100814700-100814722 CAGGCTGATCAGCTACAGAGAGG + Intergenic
1058510804 9:105713948-105713970 GGGGATGACCAGCTGCAGGGAGG + Intronic
1058510819 9:105714052-105714074 GGGGATGACCAGCTGCAGAGAGG + Intronic
1059566359 9:115386073-115386095 GGAGATGACCAGCTGCAGAGAGG + Intronic
1061709648 9:132478844-132478866 ATGAATGACAAGCTGCAGAGCGG - Intronic
1062184745 9:135211903-135211925 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1186805870 X:13139600-13139622 CAGGATGACCAGCTGCATAGAGG + Intergenic
1187465430 X:19522393-19522415 TGAGAAGACAAGCTACAGACTGG - Intergenic
1187798260 X:23028885-23028907 CGAGAAGACAAGCCACAGACTGG - Intergenic
1188848308 X:35101361-35101383 CTGGATTACAAGCTCCACAGGGG - Intergenic
1189641230 X:43073286-43073308 TGGAAAGACAAGCTACAGACTGG - Intergenic
1189856323 X:45228829-45228851 TGGGGTGACAAGCTGTAGAGAGG - Intergenic
1190008902 X:46766051-46766073 TGAAAAGACAAGCTACAGAGTGG + Intergenic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1190444843 X:50514513-50514535 TGGGATGACCAGATGCAGAGAGG - Intergenic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1190681771 X:52831837-52831859 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1191775253 X:64807149-64807171 TGGAAAGACAAGCTACAGACTGG + Intergenic
1191832170 X:65427709-65427731 CAGAATGACAAGCTACATAAAGG - Intronic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193467632 X:81868141-81868163 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1193468717 X:81875277-81875299 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1194379381 X:93175293-93175315 TGGGACCACCAGCTACAGAGAGG + Intergenic
1194380317 X:93182003-93182025 TGGGACCACCAGCTACAGAGAGG + Intergenic
1194896223 X:99443889-99443911 TGGAAAGACAAGCTACAGAATGG + Intergenic
1195071059 X:101280205-101280227 TGGAAAGACAAGCTACAGACTGG + Intronic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195178502 X:102333936-102333958 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1195180362 X:102353147-102353169 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1195894170 X:109728852-109728874 TGGAAAGACAAGCTACAGACTGG + Intronic
1197378435 X:125710048-125710070 CAAGATGACCAGCTACAGAGAGG + Intergenic
1197952100 X:131908425-131908447 CAGGACGACCAGCTACAGAGGGG + Intergenic
1198699439 X:139381995-139382017 GGGGATGACCAGCTACAGAGAGG - Intergenic
1198699450 X:139382068-139382090 GGGGATGACCAGCTGTAGAGAGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199614812 X:149647974-149647996 CGGGACAACCAGCTTCAGAGAGG + Intergenic
1199861081 X:151801074-151801096 GAGGATGACCAGCTGCAGAGAGG - Intergenic
1201796922 Y:17905951-17905973 TGGGATGACCAGCTAGAGTGAGG + Intergenic
1201804631 Y:18000034-18000056 TGGGATGACCAGCTAGAGTGAGG - Intergenic
1202358297 Y:24075010-24075032 TGGGATGACCAGCTAGAGTGAGG + Intergenic
1202512481 Y:25595103-25595125 TGGGATGACCAGCTAGAGTGAGG - Intergenic