ID: 960343981

View in Genome Browser
Species Human (GRCh38)
Location 3:116509796-116509818
Sequence ATATAGCCACTGATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960343978_960343981 5 Left 960343978 3:116509768-116509790 CCTGAAAGTTTAAGTATTTTCCA 0: 1
1: 0
2: 2
3: 47
4: 353
Right 960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG 0: 1
1: 0
2: 2
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960343981 Original CRISPR ATATAGCCACTGATGGAGCT TGG Intronic
900682633 1:3925286-3925308 AAAGAGACAGTGATGGAGCTAGG - Intergenic
900965410 1:5953882-5953904 ATATAGGAAGAGATGGAGCTAGG - Intronic
903003611 1:20283904-20283926 AAATAGCCAGTGATGGAACAAGG + Intergenic
905046836 1:35010885-35010907 GCAGAGCCACGGATGGAGCTGGG + Exonic
905247153 1:36623168-36623190 ATAAAACCACTGATGCCGCTGGG + Intergenic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
911304981 1:96222691-96222713 ATGTAGCCAGGGATGGAGGTAGG - Intergenic
911853628 1:102850954-102850976 ACATAGCCACTGAAGATGCTGGG + Intergenic
913211456 1:116585920-116585942 AGATTGCTACTGATGGAACTGGG + Intronic
914578147 1:148995035-148995057 ATTTATCTACTGATGGACCTAGG + Intronic
916002778 1:160632875-160632897 ACAGAGCAAGTGATGGAGCTAGG - Intronic
916642259 1:166743071-166743093 GGATAGCCACTGATGGACTTAGG + Intergenic
917778479 1:178364358-178364380 ATATAGCCAGTATTGGAGGTTGG - Intronic
918123915 1:181565716-181565738 ATATAGCTAATCATGGGGCTTGG + Intronic
920025531 1:202991732-202991754 ATATAGTCACTCAGGGAACTAGG - Intergenic
920767760 1:208849919-208849941 ATAAAGTCACAAATGGAGCTAGG - Intergenic
1064604825 10:17028066-17028088 CGATAGTCACTGATGGAGCAAGG + Intronic
1066599656 10:37091262-37091284 ATATAGCAAATGGTGGAGATAGG + Intergenic
1069251122 10:66268447-66268469 ATTTAGCCTCTTATGGGGCTTGG - Intronic
1072562612 10:96590028-96590050 GTATAGCCACTGGGGGAGGTGGG - Intergenic
1075564631 10:123494529-123494551 AGATTGCTAATGATGGAGCTGGG - Intergenic
1078424526 11:11238514-11238536 AGATGGCCAACGATGGAGCTGGG + Intergenic
1079513229 11:21235501-21235523 CTATAGAGACTGATGGAGCGGGG + Intronic
1082172579 11:49023977-49023999 ATATTGCAACTGAAGGGGCTGGG - Intergenic
1083554974 11:63618882-63618904 AATTAGCCACTCATGGTGCTGGG + Intergenic
1083992507 11:66255482-66255504 ATATTGCCACTGGTTGGGCTGGG - Intergenic
1085981743 11:81733869-81733891 ATGTAGCCACTGCTGGGGGTTGG + Intergenic
1086693186 11:89812076-89812098 ATATTGCAACTGAAGGGGCTGGG + Intergenic
1087026659 11:93656619-93656641 ACATAGCCATTGAGGGGGCTTGG - Intergenic
1087144971 11:94801943-94801965 ACATAGCCACTGAGGTCGCTTGG - Intronic
1088767616 11:112999052-112999074 ATATACCCTCTGAAGGAGGTAGG - Intronic
1089035317 11:115383591-115383613 ACTTAGCCACTGATGCAGGTGGG - Intronic
1089657327 11:119959634-119959656 ATACAGTCACTGATGAAGCTAGG + Intergenic
1090925673 11:131248460-131248482 AGACAGCCTCTGATGGGGCTGGG + Intergenic
1091128326 11:133122212-133122234 ATATAGACATGGACGGAGCTTGG + Intronic
1093079742 12:14795786-14795808 ATATATCCAGTGGTGGAGGTTGG + Intronic
1093772500 12:23033868-23033890 ATTTGGCCACTGATCCAGCTTGG - Intergenic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1095772780 12:45980520-45980542 ACCTAGCAAGTGATGGAGCTGGG + Intronic
1095783984 12:46090314-46090336 ATATCCCCACTCAAGGAGCTGGG - Intergenic
1096425322 12:51496656-51496678 AGAAAGCCTCTGCTGGAGCTGGG - Intronic
1098178902 12:67824359-67824381 GTATAGCCAATGATGGGACTTGG - Intergenic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1099101203 12:78442785-78442807 ATGTAACCACTGATGAAGTTAGG + Intergenic
1099909391 12:88811148-88811170 TTATAGCTAATGATGGTGCTAGG - Intergenic
1102558838 12:113747748-113747770 AATTAGCCACTGGAGGAGCTGGG - Intergenic
1104033965 12:125085666-125085688 ATGTAGCCACTGGGGCAGCTGGG + Intronic
1104052012 12:125201621-125201643 AGCTAGCCAGTGGTGGAGCTGGG - Intronic
1106286686 13:28324180-28324202 ATAAAGCCACTGAAAGTGCTAGG - Intronic
1107438231 13:40401095-40401117 ACATAGCCACTGTTGTAGCATGG + Intergenic
1108556831 13:51601700-51601722 ATGTAGAAACTGATGCAGCTAGG + Intronic
1110603880 13:77408909-77408931 ATTTAGCAAGTGCTGGAGCTGGG + Intergenic
1110786237 13:79530410-79530432 AAATTGCCACAGCTGGAGCTGGG - Intronic
1111420608 13:88005650-88005672 ATCTAGCCACTGGTGGAGCTGGG - Intergenic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1113396663 13:109954414-109954436 ATATCCCCATTGATGGTGCTTGG - Intergenic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1115039885 14:28910563-28910585 AACTAGTTACTGATGGAGCTGGG + Intergenic
1115298740 14:31859920-31859942 ATCTAGCAGGTGATGGAGCTTGG + Exonic
1115841230 14:37472981-37473003 ATTTAGACACTGCTGTAGCTTGG + Intronic
1115907170 14:38212283-38212305 GTATAGCCACTGATGGTGACAGG + Exonic
1115976354 14:39001324-39001346 AGAAAACCAATGATGGAGCTAGG - Intergenic
1117263334 14:54059647-54059669 CTATAGCCTCTGATGGATCTGGG - Intergenic
1117385916 14:55212711-55212733 CTATATCCGCTGATGGGGCTGGG + Intergenic
1123909577 15:24954109-24954131 ATTTAGACGCTGATGTAGCTTGG - Intronic
1123963905 15:25437708-25437730 ATACAGACACTGGTGAAGCTTGG - Intronic
1127214594 15:56811010-56811032 ATATATCTGCTGATGGGGCTGGG - Intronic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128893792 15:71354579-71354601 ACAAAGCCATTGAAGGAGCTTGG + Intronic
1130709909 15:86269960-86269982 ATAGAACCACTGCTGGTGCTGGG - Exonic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1133360959 16:5173487-5173509 ATATACCCACTGATGGCTCTAGG + Intergenic
1135524162 16:23201102-23201124 AGATAGCCACTTAAGCAGCTGGG + Intronic
1139872406 16:70118163-70118185 AGATAGCAGTTGATGGAGCTAGG + Intronic
1140721268 16:77774563-77774585 ACATAGCCACTGGTGAAGCTGGG - Intergenic
1141526748 16:84616894-84616916 AGATAGCCACTGATGGGGAGGGG - Intronic
1142210409 16:88805848-88805870 ATCGAGCCACTGCTGGAGCAGGG + Exonic
1149460291 17:56824060-56824082 TTATTGCCACTGATGGTGTTGGG + Intronic
1151030873 17:70737328-70737350 ATAAAGCAACTGAAGAAGCTTGG - Intergenic
1152425890 17:80218498-80218520 ACATTGCCTCTGAGGGAGCTGGG - Intronic
1154508467 18:15067468-15067490 ATAGAGTCAGAGATGGAGCTGGG + Intergenic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1157952284 18:52053122-52053144 ATTTAGCCGCTGATGGAAATGGG + Intergenic
1158023846 18:52872418-52872440 AGATTTGCACTGATGGAGCTGGG - Intronic
1160474009 18:79166649-79166671 ACACAGCCAGTGATGAAGCTTGG + Intronic
1166183382 19:41123989-41124011 ATACACCCAGAGATGGAGCTTGG - Intronic
1168614330 19:57825662-57825684 ATTTAGGAAATGATGGAGCTTGG + Intronic
1168624299 19:57904672-57904694 ATTTAGGAAGTGATGGAGCTTGG - Intronic
925054425 2:846246-846268 ATAGAGCCACTGCTGGAGGATGG - Intergenic
926881407 2:17548573-17548595 ATATAGCACCTGAAAGAGCTTGG + Intronic
929480031 2:42297062-42297084 ATATGGCCAATGATTGAGATAGG - Intronic
931924798 2:67060334-67060356 CTATAGCCACTGATGGAGGTGGG - Intergenic
935048987 2:99507832-99507854 ATGTAGCCTCTGATTGATCTAGG + Intergenic
937452365 2:122012219-122012241 ATGTGGCCACTGGTGGAGCTGGG + Intergenic
938671702 2:133592873-133592895 ATCTAGCCCCTGATGAAGCTGGG - Intergenic
939545580 2:143548429-143548451 ATATAGCCAGTGTCTGAGCTAGG - Intronic
941164133 2:162067090-162067112 ATTTAGCCACTGTTGGACCTTGG + Intronic
942100755 2:172580949-172580971 ATATGACCACTAAAGGAGCTAGG + Intronic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
943641597 2:190364937-190364959 ATATAGACACTGCTGGTCCTTGG + Intronic
943844972 2:192634417-192634439 ATATGGCCACTGCTGGAGGATGG - Intergenic
944847075 2:203679857-203679879 ATACAGCCACTAAGTGAGCTTGG - Intergenic
945853173 2:215034487-215034509 TTTTAGTCACTGATGGAGCTTGG - Intronic
1169056024 20:2621680-2621702 ATAAAACCCCTAATGGAGCTTGG + Intronic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950676689 3:14558441-14558463 CCAAAGGCACTGATGGAGCTAGG - Intergenic
951194774 3:19812005-19812027 ATATAAAAACTGATGGGGCTGGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954660626 3:52224987-52225009 ACTGAGGCACTGATGGAGCTGGG - Intronic
955500033 3:59574400-59574422 AGCTTGCCACTGGTGGAGCTGGG - Intergenic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
961311850 3:126007383-126007405 CTCTAGCCACTGCTTGAGCTCGG - Intronic
961969463 3:130945126-130945148 TGAGAGGCACTGATGGAGCTAGG + Intronic
967832883 3:193935997-193936019 ATAAAGCCACTGTTAGAACTAGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
972176712 4:36417238-36417260 ATATATCCGCTGATGGGGCTGGG + Intergenic
973828193 4:54730888-54730910 ATATAGTGACTGATGGAGGAAGG - Intronic
975023463 4:69520317-69520339 ACACAGCCACTGCTGGAGTTGGG + Intronic
976656418 4:87493224-87493246 ATTTGGCGACTGAAGGAGCTAGG - Intronic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
981558722 4:146023869-146023891 ACATGGCCACTGCTGGGGCTGGG + Intergenic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
985873700 5:2578968-2578990 ACAGAGCCGCTGATGGGGCTAGG - Intergenic
986248266 5:6031055-6031077 AGCTAGCAACTGATGGAGTTAGG + Intergenic
989421126 5:41240788-41240810 ATCTAGCCACTAAGGGACCTGGG - Intronic
992836090 5:80642946-80642968 CAATAGCCTCTGATGGATCTGGG + Intronic
993509284 5:88751610-88751632 ATATAGCCACAGGAGGAGATAGG + Intronic
993933605 5:93973062-93973084 CTTTAGCCACTGAAGCAGCTGGG + Intronic
999430393 5:151520728-151520750 AGCTAGTGACTGATGGAGCTAGG + Intronic
999947800 5:156616328-156616350 ATATTCCCACTGCTAGAGCTAGG + Intronic
1000396272 5:160777651-160777673 ACATAGTCACTGCTGGAGCCAGG - Intronic
1002169901 5:177369158-177369180 AGAGAACCACTGTTGGAGCTGGG + Intronic
1007040054 6:38713729-38713751 CTTTTGGCACTGATGGAGCTGGG - Intergenic
1008537381 6:52517035-52517057 ATAGAGCCAGTGATGGGGATTGG - Intronic
1008547595 6:52597089-52597111 AGCTAGCAACAGATGGAGCTAGG - Intergenic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1011821873 6:91262442-91262464 ATGCACACACTGATGGAGCTGGG + Intergenic
1012181321 6:96156512-96156534 ATATATAAGCTGATGGAGCTGGG + Intronic
1012297276 6:97540820-97540842 ATATGTCCACTGAAGGATCTTGG + Intergenic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016798900 6:148148156-148148178 ATAGAGCCATTTATGGAGATTGG + Intergenic
1021127989 7:16876268-16876290 ATATAGCCAGAGATAGAGATAGG - Intronic
1023384443 7:39641611-39641633 ATATGGACACTGACAGAGCTTGG - Intronic
1025147121 7:56514450-56514472 ATATATGCACTGAGGGAACTGGG - Intergenic
1027999277 7:85470430-85470452 ATAGAAACACTGATGAAGCTAGG + Intergenic
1028364491 7:90011678-90011700 ATACAGTAAATGATGGAGCTGGG + Intergenic
1029513492 7:101011367-101011389 CAATAGCCAATGATGCAGCTGGG - Intronic
1033732013 7:144189306-144189328 AAATAGAAACTGATGGAACTGGG + Intronic
1033742862 7:144287889-144287911 AAATAGAAACTGATGGAACTGGG + Intergenic
1033751040 7:144361725-144361747 AAATAGAAACTGATGGAACTGGG - Intronic
1036908537 8:12731136-12731158 ACACAGCAGCTGATGGAGCTGGG - Intronic
1038012030 8:23483004-23483026 ATACAGCCGATGATGGGGCTAGG - Intergenic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1042826161 8:72981885-72981907 ATCTAGTAAGTGATGGAGCTAGG - Intergenic
1042890153 8:73600586-73600608 ACATAGGGACTGATGAAGCTGGG - Intronic
1043159685 8:76830076-76830098 CCATAGCAAGTGATGGAGCTGGG - Intronic
1045615412 8:103903910-103903932 ATATAACCACTGAGGAAACTCGG - Intronic
1046200538 8:110921980-110922002 ATATACCCAATGATGGAACCGGG - Intergenic
1047242440 8:123103885-123103907 ATAAAGACACTGATGGTACTGGG - Intronic
1048422862 8:134294486-134294508 CTATAGCCACTGGTGGACTTGGG - Intergenic
1050689444 9:8208868-8208890 AGATAGCCAGTGAGGGAACTGGG + Intergenic
1051009951 9:12399466-12399488 ATAATTCCACTGATGGATCTGGG + Intergenic
1051680480 9:19602707-19602729 AGGTAGAAACTGATGGAGCTGGG - Intronic
1052124048 9:24754112-24754134 AGCTAGTTACTGATGGAGCTAGG - Intergenic
1052515670 9:29476370-29476392 AAATAGTCAGTGGTGGAGCTAGG + Intergenic
1052672823 9:31580189-31580211 ATGTCTCCACTCATGGAGCTTGG - Intergenic
1056786728 9:89597880-89597902 ACACAGCCAATGGTGGAGCTGGG - Intergenic
1059463925 9:114453435-114453457 ATATAGTAACTGATGTAGTTTGG - Intronic
1059464582 9:114459848-114459870 ATATAGTAACTGATGTAGTTTGG + Intronic
1060287830 9:122269939-122269961 ATTTAGTCAGTAATGGAGCTAGG + Intronic
1062505741 9:136875000-136875022 ATAAAGAAACTGATGGGGCTGGG + Intronic
1187077448 X:15949035-15949057 TTATAGCCACTGATGAAGCAGGG + Intergenic
1187312419 X:18158061-18158083 TAATACCCACTGCTGGAGCTGGG + Intergenic
1189911152 X:45811557-45811579 ATAAAGGCACAGATGTAGCTAGG - Intergenic
1192673582 X:73170987-73171009 GTATAGCCACTACTGGAGATGGG + Intergenic
1193904256 X:87223948-87223970 ATGTCGCCACTAATGGAGATGGG - Intergenic
1195749200 X:108147285-108147307 ATATTGCCACTACTGGAGATGGG + Intronic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1196839235 X:119843113-119843135 AGCTAGCAACTGATGGAGGTAGG + Intronic
1201410941 Y:13698917-13698939 ATATAGGCACTAATGTAGGTGGG + Intergenic