ID: 960345764

View in Genome Browser
Species Human (GRCh38)
Location 3:116530360-116530382
Sequence CTGTATAGGTAGAAGTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960345764 Original CRISPR CTGTATAGGTAGAAGTTTAA AGG Intronic
909888165 1:80968777-80968799 CTTTACAGGTAAAAGTCTAAGGG + Intergenic
912892438 1:113548929-113548951 CTGGATGGGTAGAAGTGAAAAGG + Intronic
913308176 1:117454597-117454619 CTGTATTGTTAGAAATTTTAAGG + Intronic
916969806 1:170000480-170000502 CTGTATTGATAGAACTTTAGGGG - Intronic
922426787 1:225504341-225504363 TTTTATAGGCAGATGTTTAAAGG - Intronic
923636989 1:235708187-235708209 ATGTATAGATAGAAGTCTAAAGG + Intronic
1065199923 10:23302706-23302728 CTGTCAAGGAGGAAGTTTAAGGG - Intronic
1069088346 10:64168962-64168984 CAGTAAATGTAGAAGTTGAAGGG + Intergenic
1069259061 10:66371285-66371307 CTGTATATGTAAAAGTATAAAGG - Intronic
1070245475 10:74727544-74727566 CTGTCTATGTAGAAATCTAAAGG + Intergenic
1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG + Intergenic
1074582958 10:114737999-114738021 CTTTAAAGGTTGAAATTTAAAGG + Intergenic
1075329645 10:121564210-121564232 CTGAATAGGGAGAAGTCAAAGGG + Intronic
1077651751 11:3979075-3979097 CTTTATAGGTAGTAGTATATAGG + Intronic
1081154880 11:39677971-39677993 CTGCATAGGTATTAATTTAAGGG + Intergenic
1084475684 11:69387322-69387344 CAGGATAGATAGAAGTTTGAAGG - Intergenic
1085796686 11:79547530-79547552 ATCAATTGGTAGAAGTTTAAGGG + Intergenic
1087897090 11:103598377-103598399 CTCTATCGGTAGATGTTTATGGG + Intergenic
1091168787 11:133502555-133502577 CTGTACAGGTATATGTTTAGAGG - Intronic
1093662142 12:21769257-21769279 CTCTATAAGTAGAACTATAAAGG + Intronic
1094572728 12:31655561-31655583 CAGGATAGGTAGAAGAATAATGG - Intronic
1097986952 12:65793804-65793826 TTGTATAGTTAGCAGTCTAAAGG + Intergenic
1098509458 12:71294425-71294447 GTTTGAAGGTAGAAGTTTAATGG + Intronic
1098705477 12:73684215-73684237 CTGTGTAGATAGTTGTTTAATGG - Intergenic
1101042435 12:100770498-100770520 CTGAAAACGTAGAAGTTCAATGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107566662 13:41611917-41611939 ATATATAGGTAGTATTTTAATGG - Intronic
1110491084 13:76108811-76108833 TTGTAAATGTAGTAGTTTAAAGG - Intergenic
1112939738 13:104847187-104847209 CAGTATAAGTAGTAATTTAATGG - Intergenic
1115788984 14:36857689-36857711 TTGTATATGAAGCAGTTTAAGGG + Intronic
1117407717 14:55420654-55420676 CTGTATACTTAGAAATTTTAAGG + Intronic
1118231455 14:63954292-63954314 CCCTGTATGTAGAAGTTTAAAGG + Intronic
1124322063 15:28721465-28721487 CTTTCTAAGTAAAAGTTTAATGG + Intronic
1124523163 15:30423307-30423329 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124535503 15:30542909-30542931 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1124763151 15:32464687-32464709 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124775476 15:32584372-32584394 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1127185664 15:56477513-56477535 CTGTACATGTAGTAGTATAAAGG + Intergenic
1127711548 15:61604082-61604104 CTGTAAGGGTAGAAGTTTTATGG + Intergenic
1127908317 15:63394071-63394093 CTCTATAGGTAGAGTTTGAATGG + Intergenic
1130812542 15:87394977-87394999 CTGTATTGGTATAAGTTTCTGGG - Intergenic
1131821138 15:96275064-96275086 CTGGGTAGAAAGAAGTTTAAAGG - Intergenic
1133160898 16:3910978-3911000 CTGTCAAGGTTGAAGTTTTAAGG + Intergenic
1138803853 16:60069496-60069518 CTGTGCAGGTTAAAGTTTAAAGG + Intergenic
1138959715 16:62014436-62014458 CTGAGTAGGTAGAAGCTTCATGG + Intronic
1139218406 16:65152600-65152622 CTCTATAGGTAAAAGTTTTAAGG - Intergenic
1142658196 17:1408766-1408788 TTGTATAGTTAGATGTATAAAGG + Intergenic
1147000133 17:37356233-37356255 CTGTTAAAGTAGAAGATTAATGG + Intronic
1149376241 17:56047030-56047052 CTGGATAGATTGAAGTTGAAAGG + Intergenic
1150955921 17:69860252-69860274 CTGTTTGGGTGGAAGGTTAAAGG - Intergenic
1153509808 18:5839263-5839285 CTGTGTAGGCAGCAGTTTCATGG - Intergenic
1155018378 18:21870874-21870896 CTGTATAGTTAGAAATTTCATGG + Exonic
1155079575 18:22395037-22395059 ATGTATAGGAAGAAATGTAAAGG + Intergenic
1155752658 18:29446724-29446746 CTTTAAAGGTAGATTTTTAATGG - Intergenic
1157902934 18:51538115-51538137 ATATATAGGTATAATTTTAAAGG - Intergenic
1159181405 18:64910639-64910661 ATGTATTGGTATAAATTTAATGG - Intergenic
1163982779 19:20916798-20916820 CTGGATAGGTAAAAGATGAAGGG + Intergenic
929805825 2:45144159-45144181 TTGTAGAGGTAGAAGTTAAATGG + Intergenic
937384108 2:121410683-121410705 GTGCAGAGGTAAAAGTTTAAGGG + Intronic
938120519 2:128629781-128629803 TTGAATAGGTAAAATTTTAATGG + Intergenic
939082708 2:137682429-137682451 CTGTATAGATATAATTTTTATGG + Intergenic
939212348 2:139192857-139192879 CTGTTTGGGTAGAAGCTTCATGG + Intergenic
941978163 2:171428241-171428263 CTTCATAGGTAGAAGTCTTAAGG + Intronic
943406092 2:187488470-187488492 CTGTATAAGAATAATTTTAATGG - Intronic
944002467 2:194856294-194856316 CTGTAAAGGTTAAATTTTAAAGG + Intergenic
944306467 2:198185431-198185453 CTGTATACCTAGAAGTTTGAAGG + Intronic
1169946934 20:10999027-10999049 CTGTCTTGGTAGAAATTTAAAGG + Intergenic
1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG + Exonic
1173270901 20:41533915-41533937 CTGTATAGGAGGAAGTTTTATGG + Intronic
1177006403 21:15677701-15677723 TTGTAGAGGTAGAATTTCAAAGG + Intergenic
954261683 3:49443584-49443606 CTGTACAGGTGGATTTTTAAAGG + Intergenic
955199993 3:56842982-56843004 TTGTATAACTAGAAGTTTGAGGG - Intronic
957023010 3:75144889-75144911 CTGTATATGTTGAACTTTAATGG + Intergenic
957164427 3:76653675-76653697 ATATAAAGGGAGAAGTTTAATGG - Intronic
957458413 3:80484276-80484298 GTGTTTAGGTAGAAGTTTTCAGG - Intergenic
957710052 3:83844896-83844918 CTCTAAAGGTAGAACTCTAAAGG - Intergenic
958714755 3:97765914-97765936 CTTGAAACGTAGAAGTTTAAAGG + Intronic
960345764 3:116530360-116530382 CTGTATAGGTAGAAGTTTAAAGG + Intronic
963550815 3:146720608-146720630 CTGTATATGTACAATTTTTATGG - Intergenic
966046619 3:175558730-175558752 CTGTATATGTATGAGTTTATCGG + Intronic
967459535 3:189729311-189729333 CTAAATATGTAGAACTTTAATGG + Intronic
967771073 3:193333835-193333857 CTGTATAGTTTGAAGTTCAGAGG + Exonic
977432579 4:96950162-96950184 CTGAATAGGAAAAATTTTAATGG + Intergenic
982891195 4:160852811-160852833 CTCTAAAGGCAGAATTTTAAGGG + Intergenic
987403974 5:17506602-17506624 CTGTGGAGGTGGAAGTTAAAGGG - Intergenic
987411445 5:17619350-17619372 CTGTGGAGGTGGAAGTTAAAGGG - Intergenic
987933627 5:24434626-24434648 CTGTAAATGTAGAATTTCAAGGG + Intergenic
988736727 5:34029684-34029706 CTTTCTTGGTAGAAGTTTCATGG + Intronic
989469871 5:41803215-41803237 CTGTATATGTAGAAGATTTATGG - Intronic
989773574 5:45174214-45174236 TTAAATAGGTAGAAGTTTATAGG - Intergenic
989788701 5:45364351-45364373 TTGTAAGGGTAGATGTTTAAAGG - Intronic
989788714 5:45364492-45364514 TTGTAAGGGTAGATGTTTAAAGG - Intronic
990110952 5:52323799-52323821 CTGTTGAGGGAGAACTTTAAAGG - Intergenic
991181351 5:63754774-63754796 CTGTGTAGGTAGTCATTTAAGGG - Intergenic
991544602 5:67767547-67767569 CTGAATAGGTATAAGTTAAGAGG + Intergenic
991556203 5:67897414-67897436 CTGTAGAGGCAGAAGTTTGTGGG - Intergenic
991562400 5:67967736-67967758 CTTTATAAGTACAAGTTTTAGGG - Intergenic
993523360 5:88933504-88933526 CTGTCCAGGTAGAAGAATAAAGG - Intergenic
994687003 5:102968246-102968268 ATGTATAGGAAAAAGTGTAATGG + Intronic
994839919 5:104910356-104910378 CTGTATAGGTAGTAATAGAAAGG - Intergenic
995344777 5:111099609-111099631 CTGTGCAGATAGAAGTTAAAAGG + Intronic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
997139576 5:131364296-131364318 CTGTATAGGCACAAGTTTAAGGG + Intronic
998729471 5:145058230-145058252 CTGTATAAGTAGTACTTTTAAGG - Intergenic
1001062911 5:168509290-168509312 CTGTATAAGCAGAATTTTACAGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003612613 6:7627230-7627252 CTGAAATGGTAGAAGTTTATGGG + Intergenic
1007202648 6:40123162-40123184 CTGAATAAGCAAAAGTTTAATGG + Intergenic
1009041099 6:58178101-58178123 CTGTATATTTGCAAGTTTAAAGG - Intergenic
1009216958 6:60932638-60932660 CTGTATATTTGCAAGTTTAAAGG - Intergenic
1009642649 6:66358052-66358074 ATGTATATGTAGAATTTGAATGG + Intergenic
1009857244 6:69280508-69280530 CTTTATATGTATAAGTCTAATGG - Intronic
1014601909 6:123423724-123423746 ATATTAAGGTAGAAGTTTAAAGG - Intronic
1017395123 6:153990006-153990028 CTATATAGGCAGAAGGTTGAAGG - Intergenic
1021974541 7:25998943-25998965 TTATGTAGGAAGAAGTTTAATGG - Intergenic
1022423025 7:30241952-30241974 CTGTATAGATAGATGTTAACTGG - Intergenic
1022769994 7:33459499-33459521 CTCTATAGGAAGAAATTAAAAGG + Intronic
1028195941 7:87908133-87908155 CAGTAAATGTAGAAGTTGAAGGG - Exonic
1031835424 7:126675787-126675809 CTGAATGGGCAGAAGTTGAAAGG + Intronic
1037058023 8:14469207-14469229 CTGTATAGGTAGTAGTAAGATGG - Intronic
1037790598 8:21936799-21936821 CTTTATAGGTAGAATTTTCTGGG + Intronic
1038362287 8:26892686-26892708 CTGAATGGGGAGAAATTTAATGG + Intergenic
1041440244 8:57887412-57887434 CTTTAAAGATAGGAGTTTAAGGG + Intergenic
1044051650 8:87513482-87513504 CTGAATACATAGATGTTTAAGGG + Intronic
1047034733 8:120924858-120924880 CTGTAGGGGTAGAAGTTAAGTGG + Intergenic
1048732594 8:137460455-137460477 CTGCATAGGTAGAAGTTGAGTGG + Intergenic
1052103779 9:24485572-24485594 CCATAAAGGTAGAAGTTGAAAGG - Intergenic
1056905301 9:90642424-90642446 CTGTTAATGTGGAAGTTTAATGG - Intronic
1056934173 9:90903247-90903269 CTGAACAGGTGGAAGTTTGAGGG - Intergenic
1057516255 9:95724189-95724211 CTGTAGGGGTAGAAGTTAACTGG - Intergenic
1058260564 9:102824841-102824863 CCATATAAGAAGAAGTTTAAGGG - Intergenic
1058476059 9:105334186-105334208 CTGCATAGATAGAACATTAATGG + Intronic
1059612078 9:115909289-115909311 CTGTATATGTGGAAGATAAAAGG + Intergenic
1187791121 X:22951259-22951281 CTGTATAGCTAGAGCTTAAAGGG - Intergenic
1188145056 X:26601825-26601847 CTGTATAGGTATAACTAAAATGG - Intergenic
1190365279 X:49687469-49687491 CTTTATTGGGAGAATTTTAATGG + Exonic
1195135389 X:101901403-101901425 CTGAATAGGGAAAAGTTGAAAGG - Intronic
1196193808 X:112819946-112819968 CTGTATAGCTAGTTGGTTAAAGG + Intronic
1197834437 X:130679383-130679405 CTTTAAAGGAAGAAGTTGAATGG + Intronic
1198480585 X:137036126-137036148 CTGTATAGGGAGATGTTTGAGGG + Intergenic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1199106832 X:143878120-143878142 CTATATATGTAGAATTATAAAGG + Intergenic
1202338470 Y:23834949-23834971 CTTTAGGGGTAGCAGTTTAATGG - Intergenic
1202532296 Y:25835123-25835145 CTTTAGGGGTAGCAGTTTAATGG + Intergenic