ID: 960346902

View in Genome Browser
Species Human (GRCh38)
Location 3:116544442-116544464
Sequence AGCCATAAAAATAATGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 11, 3: 44, 4: 341}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960346902 Original CRISPR AGCCATAAAAATAATGAGGT CGG Intronic
901386164 1:8910739-8910761 AACAATTAAAACAATGAGGTTGG + Intergenic
902520650 1:17013863-17013885 AGCAATAAAAAGAATGAAGGGGG - Intergenic
904473197 1:30748421-30748443 GGCCATAATAATAATGATGATGG - Intronic
904778575 1:32927164-32927186 AGCCAGAGAAATAGAGAGGTGGG + Intergenic
905976751 1:42181083-42181105 AGACATAAAGGTAATGGGGTTGG - Intronic
906079625 1:43076215-43076237 AGCCATAAAAAGAATGAAATTGG - Intergenic
907886964 1:58601079-58601101 AACCATAAAAATGATGAAGATGG - Intergenic
907932080 1:59010018-59010040 AGCCATCAACATAATGAAGGAGG - Intergenic
908393695 1:63706041-63706063 AGTCATAAAGAGAATGAAGTTGG + Intergenic
909755879 1:79224737-79224759 ATTCAGAAAAATAATAAGGTTGG + Intergenic
909967549 1:81934164-81934186 ATCAATAAAAATTATGTGGTTGG + Intronic
910200950 1:84697963-84697985 AGTAATAATAATAATGAGATTGG + Intergenic
911935503 1:103965120-103965142 AGACATAAAAATCATCAGGATGG - Intergenic
911960298 1:104293374-104293396 ATTCATAAAAATTCTGAGGTAGG + Intergenic
912647759 1:111411218-111411240 AGCCATAAAAAAAACAAGATCGG + Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912946663 1:114090437-114090459 AGCCCTAAAAATGACCAGGTTGG - Exonic
913574702 1:120160566-120160588 GGCCATCAAAGTACTGAGGTAGG + Intronic
914295971 1:146325406-146325428 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914499013 1:148227499-148227521 AGCCCTTTAAAGAATGAGGTAGG + Intergenic
914557011 1:148776192-148776214 GGCCATCAAAGTACTGAGGTAGG + Intergenic
914615823 1:149354038-149354060 GGCCATCAAAGTACTGAGGTAGG - Intergenic
918420693 1:184361575-184361597 AGTCATAGAACTATTGAGGTAGG - Intergenic
918445609 1:184614008-184614030 AGAAATAAAAATAAAGAGATGGG + Intronic
918913355 1:190602919-190602941 AACCAAAACAATAATGATGTAGG - Intergenic
921032036 1:211342346-211342368 ACCCATAAAAATAAAAAAGTAGG - Intronic
921837844 1:219795942-219795964 AGCCTTGAAAAGAAAGAGGTGGG + Intronic
921879425 1:220237532-220237554 AGAAATTAAAATAATGAGTTAGG + Intronic
922305762 1:224343004-224343026 AGCAAAAAAAATAATTAGCTGGG - Intergenic
1064138498 10:12770856-12770878 AGCAAGAAAAAAGATGAGGTTGG + Intronic
1064270419 10:13860273-13860295 TGCCATAAAAATAATTAGGAAGG + Intronic
1064481229 10:15742828-15742850 AGGCATAAAAGAAATGAGGCAGG - Intergenic
1064489321 10:15834152-15834174 AGCCATAAAAAGCTTGAGGAGGG + Intronic
1064552369 10:16517060-16517082 AGCCATCAAACTATTGAGGAAGG + Intronic
1065264123 10:23957308-23957330 ATCCATAAAGACTATGAGGTAGG - Intronic
1067535054 10:47102964-47102986 TGCCATCAAAATAAGGAGGAAGG + Intergenic
1068073663 10:52227164-52227186 AACCTTAAAAATAATGTGATGGG - Intronic
1068264578 10:54629993-54630015 AGCCACAAAAAAAATTAAGTAGG + Intronic
1068704517 10:60058999-60059021 TTCCTTTAAAATAATGAGGTGGG - Intronic
1069472211 10:68703420-68703442 ACACATAAAAATAATAAAGTCGG + Intergenic
1069481560 10:68787316-68787338 AGCTATAAAAAGAATGAGGCAGG - Intronic
1070240140 10:74672119-74672141 AACAATAAATATAATGAAGTAGG - Intronic
1070940642 10:80343121-80343143 AGCTATAAAAAACAGGAGGTGGG - Intronic
1071787889 10:88923191-88923213 AGACATAAAAATAATTGTGTTGG + Exonic
1071948458 10:90675277-90675299 AGAAAAAAAAATAATGAGTTTGG - Intergenic
1072060048 10:91800695-91800717 AGTAATAAAAATTATGAAGTGGG + Intronic
1072147815 10:92658249-92658271 AGCCAGAAAAAAAATTAGCTGGG - Intergenic
1073715451 10:106101432-106101454 GGCAATAAAAATTAGGAGGTGGG + Intergenic
1075792052 10:125091902-125091924 AACCATAAAAATAATCATGGGGG - Intronic
1075865240 10:125713195-125713217 AGACATAAAAACAATGTTGTTGG - Intergenic
1076205005 10:128590537-128590559 AGACATCAAAATATTTAGGTAGG + Intergenic
1078294089 11:10048062-10048084 ACACATAAAGATAATGATGTCGG - Intronic
1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG + Intronic
1080286296 11:30617587-30617609 AGCAAGAGAAATAATGAAGTGGG + Intergenic
1083433963 11:62630192-62630214 AGCTATGACAATTATGAGGTAGG - Exonic
1083868727 11:65473503-65473525 AACAATAAAAAGAGTGAGGTAGG + Intergenic
1085873370 11:80376913-80376935 AGCCATATAAAAAATGATCTAGG - Intergenic
1086247472 11:84770950-84770972 AGCCATAAAAAGAATGAAATCGG - Intronic
1086466321 11:87057723-87057745 AACCTTAAAAATAAAGACGTTGG + Intronic
1086494612 11:87389258-87389280 AGCCATAAAAAAGATGAGATTGG + Intergenic
1086646969 11:89234620-89234642 AGACACAAAAATATTGAGATTGG - Intronic
1087454517 11:98366405-98366427 AGATATGAAAATAGTGAGGTAGG + Intergenic
1089750248 11:120646504-120646526 AGCAAAAAAAATAATTAGGATGG - Intronic
1089763094 11:120742930-120742952 AGCCATAAAAAGAATGAGATTGG + Intronic
1089993920 11:122886746-122886768 AGCCAAAAAAAGAATTAAGTGGG - Intronic
1090501505 11:127265670-127265692 GGCCCTAAAAATATTGAGGGTGG + Intergenic
1090909832 11:131109359-131109381 TGCCCTAAAAATACAGAGGTGGG + Intergenic
1092626208 12:10332080-10332102 TGCCAAAAAAATAATAAGGTTGG + Intergenic
1093192057 12:16086257-16086279 AGCCAAAAAACAAATGAGGAAGG + Intergenic
1093373309 12:18390509-18390531 AGCCAGAAAAAAAAGGAGGCTGG + Intronic
1093741627 12:22695009-22695031 ATACATAAAAATAATTATGTAGG - Intergenic
1095362049 12:41354187-41354209 AGCCTTAATAGTAATAAGGTAGG + Intronic
1097660555 12:62425791-62425813 AGTCATATAAATAATGTGTTAGG - Intergenic
1097767616 12:63543540-63543562 AGGCACAAAAATAATTAGCTGGG - Intergenic
1097783983 12:63738576-63738598 AGGCACAAAAATAATTAGCTGGG - Intergenic
1098407849 12:70144973-70144995 AGTCATGAAAATAATGAGTATGG + Intergenic
1098688025 12:73450775-73450797 AGTCATAAAAAAAAGAAGGTGGG - Intergenic
1099066977 12:77993157-77993179 CGTCTTTAAAATAATGAGGTGGG + Intronic
1099695916 12:86019247-86019269 CTCCATAAAACTCATGAGGTAGG + Intronic
1099779690 12:87177726-87177748 AGTCATAAATTTAATGAAGTAGG + Intergenic
1100770886 12:97921799-97921821 AGCCAGAGAGATAAAGAGGTGGG - Intergenic
1101977117 12:109369246-109369268 AGCCATGAAAAGAATGAGCCAGG - Intronic
1103475853 12:121218184-121218206 AGCCATAAAAGTCAGGAGGAAGG + Intronic
1103542429 12:121675388-121675410 AAAAATAAAAATAATGAGGCCGG - Intergenic
1105667111 13:22572421-22572443 ATCCTTAAAAATAATGAAATGGG + Intergenic
1107670243 13:42738281-42738303 AACCATTAAAATATTGAGGTAGG - Intergenic
1109084062 13:57947622-57947644 ACCAATAAAAATAATGAAATGGG - Intergenic
1109830133 13:67774988-67775010 TTCTATAAAAATAATGTGGTTGG + Intergenic
1111419927 13:87998909-87998931 AGCCAAAAAAAAAAGGGGGTGGG - Intergenic
1111548597 13:89778419-89778441 AGCCAGAGAAATAGTGATGTGGG + Intergenic
1111792849 13:92880545-92880567 ATCTTTAAAAATAACGAGGTGGG + Intergenic
1112390077 13:98975079-98975101 AGCCATTAAAATAATGGCATAGG + Intronic
1112843670 13:103611142-103611164 AGCCATAAAAACAATGAATAAGG - Intergenic
1112846012 13:103644849-103644871 AGCCATAAAAGAAATGAAGAAGG - Intergenic
1112881566 13:104112834-104112856 AGTTATAAAAATAATGAGGTTGG - Intergenic
1113253038 13:108475587-108475609 AGCCATGAAAATAAAGAAGCAGG - Intergenic
1114778030 14:25508077-25508099 ATCCAAAAAAAGAATAAGGTTGG - Intergenic
1115306020 14:31934417-31934439 AGCCATTAAAATCATGTGGCAGG - Intergenic
1115381452 14:32744784-32744806 AGGAATAAAAACAATGAAGTAGG - Intronic
1116300972 14:43182540-43182562 AGCAATAAAAATAATCATTTGGG - Intergenic
1116999556 14:51358417-51358439 AGCCTTCAAAATACTAAGGTGGG + Intergenic
1117283194 14:54260519-54260541 AGAAATAAAAATCATGAGTTAGG - Intergenic
1118647839 14:67857404-67857426 GTACATAAAAATAATGAAGTAGG + Intronic
1119122836 14:72095966-72095988 AACCTTAAAAATAATGAGGAGGG + Intronic
1119154841 14:72400416-72400438 ATCTATAAAAATCAGGAGGTGGG - Intronic
1119355684 14:74004461-74004483 AACCACAGAAATAATGAGATAGG - Intronic
1120631372 14:86895741-86895763 AGTCATAAAACTAATTAGTTGGG + Intergenic
1121234593 14:92383095-92383117 AGCCATAGAAATGATGGGCTGGG - Intronic
1124856793 15:33396928-33396950 TACCAGAAAAATAAAGAGGTTGG - Intronic
1126288357 15:47042564-47042586 AGCCTTAAAAAGAAAGAAGTTGG - Intergenic
1126300315 15:47187344-47187366 AGACATAAAAATCTTGAGATTGG - Intronic
1126470766 15:49007796-49007818 AGTCATAAAAGTAAGGAGCTAGG + Intronic
1126746942 15:51835764-51835786 CTACATAAGAATAATGAGGTTGG - Intronic
1127376911 15:58393495-58393517 AGTTTTAAAAAAAATGAGGTGGG + Intronic
1128471572 15:67958099-67958121 AGCCATGAAAATATTAAGCTGGG - Intergenic
1129414223 15:75366342-75366364 AACCATAAAAATAATGGGCTGGG - Intronic
1131193495 15:90336116-90336138 GCCATTAAAAATAATGAGGTTGG - Intergenic
1131760791 15:95620431-95620453 AGCCATAAAAAGAAAGAAGATGG - Intergenic
1133245601 16:4446932-4446954 AGCTATAGAAATAAAGAGGTCGG - Exonic
1133532882 16:6672307-6672329 AACCATACAAATATTGTGGTGGG + Intronic
1133554076 16:6887961-6887983 AGTAATAAAAATGATGAGGATGG - Intronic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1136042677 16:27592848-27592870 AGAAATAAAAATAATAAGCTGGG - Intronic
1137377697 16:47967677-47967699 AGCCATAGAAATCAAGATGTAGG - Intergenic
1137915470 16:52425111-52425133 AGCCATAAAACTAATTATTTTGG + Intergenic
1138646353 16:58428126-58428148 AGCCATAAAAAGATGGAGGTAGG - Intergenic
1140060984 16:71569495-71569517 AGAAATAAAAAAAATGAGCTGGG - Intronic
1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG + Intergenic
1141301593 16:82821186-82821208 AACCAGAAAAATAATGATGTGGG - Intronic
1141484774 16:84331461-84331483 AGTAATAATCATAATGAGGTTGG - Intergenic
1143441985 17:6981999-6982021 AACTATAAAAATAATTAGCTGGG - Intronic
1144820400 17:18069316-18069338 AGAAATAAAAAAAATTAGGTGGG - Intergenic
1145922608 17:28621743-28621765 AGCCAGAAAAACAATGAGAAAGG + Intronic
1146559915 17:33859156-33859178 AGCTATAAAAATAATAGTGTTGG + Intronic
1147417494 17:40303938-40303960 AGCCTCAAACACAATGAGGTGGG - Exonic
1147700991 17:42394812-42394834 AGCCTTGAAAATATTGAGCTGGG - Intergenic
1148929327 17:51115347-51115369 AACCATAAAAAAAATTAGTTGGG - Intronic
1151292590 17:73161324-73161346 AGCCAGAAAAATAGAGGGGTTGG - Intergenic
1151650513 17:75465833-75465855 TGCCATAAAAAAATTGACGTTGG - Intronic
1151900845 17:77013152-77013174 GGCGATAAGAATAATGAGGCTGG + Intergenic
1152173089 17:78766806-78766828 AGACATAAAAATGAAGAGGGGGG + Intronic
1203166445 17_GL000205v2_random:101331-101353 AGCCTAAAAAATAATGAAATTGG + Intergenic
1153352269 18:4094296-4094318 AGCAATAAAAATAGTGAAGATGG + Intronic
1153479869 18:5536430-5536452 ACCATTAAAAATAATGATGTGGG + Intronic
1153587986 18:6643869-6643891 AGACACAAAAATATTGAGGGTGG - Intergenic
1155060231 18:22222191-22222213 AGCCAAAAGAATAATGAAGCTGG + Intergenic
1155690522 18:28616367-28616389 AGTCATAAAAATAATAAGATTGG - Intergenic
1156170279 18:34474769-34474791 ATCCATCAAAAAACTGAGGTTGG - Intergenic
1156207593 18:34903291-34903313 AGCCTTAAACATACTGACGTGGG + Intergenic
1156895150 18:42237516-42237538 AGCCAAAAAAATAATGAGGGAGG - Intergenic
1158421274 18:57296894-57296916 AGCCATATAAACAATGTGCTGGG + Intergenic
1161716543 19:5879366-5879388 AGCCTTACAAAAAATGAGCTGGG + Intronic
1163225251 19:15956024-15956046 AGTCATAAAATTGATGAGGAGGG + Intergenic
1163354670 19:16802297-16802319 AAAAATAAAAATAATGAGCTGGG + Intronic
1164801062 19:31077123-31077145 AAGTATAAAAATAATGAGGTGGG - Intergenic
1164917949 19:32066934-32066956 AGTCATTAAAAGAATGAGATAGG + Intergenic
1165680374 19:37769266-37769288 ACACATAAAAATAAACAGGTAGG - Intronic
1165979987 19:39712961-39712983 AGGCATAAAAATAATATGATGGG - Intergenic
1166273395 19:41733320-41733342 AGAGACAAAAATAATGAGCTGGG + Intronic
1167914539 19:52730091-52730113 AACCATAAAAAACATGATGTAGG + Intronic
926609149 2:14928292-14928314 AGAGATAAAAATAATGACTTTGG - Intergenic
928138873 2:28710275-28710297 GGCCACAAAAATAATGGGGATGG - Intergenic
928209700 2:29314390-29314412 AGCAATAAAAGGAATCAGGTTGG - Intronic
928444850 2:31324662-31324684 ACTCATATAAAGAATGAGGTGGG + Intergenic
930246389 2:48987503-48987525 AAAAATAAAAATAATCAGGTGGG - Intronic
931121532 2:59225588-59225610 GGCCCTAAAAATACTGAGGAGGG + Intergenic
931337949 2:61367920-61367942 AGTTATAACAATAATGAGGAAGG + Intronic
931356507 2:61541685-61541707 AAAAATAAAAATAATGAGATAGG + Intergenic
931587672 2:63845906-63845928 ATTAATAAAAATATTGAGGTAGG + Intronic
931587775 2:63846838-63846860 AGCCATGAAAATAATGACTAGGG + Intronic
932016223 2:68029912-68029934 AGCCATAAAAATAATAAATCTGG + Intergenic
932087733 2:68776603-68776625 GGCCAAAAAAGCAATGAGGTTGG - Intronic
933029480 2:77309822-77309844 AGCCATTAAAATAATAATGTAGG + Intronic
933382619 2:81568901-81568923 AACCATAAAAATAATTAGCTGGG + Intergenic
934103421 2:88674679-88674701 ATCAATAACAACAATGAGGTGGG + Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
936245607 2:110824304-110824326 AGCCAAAACAATATTGAAGTAGG - Intronic
936599573 2:113882531-113882553 AGACATAAAAATACTGATGTCGG - Intergenic
936806410 2:116337525-116337547 AATCATAAAAATAATGAGGAGGG + Intergenic
938682902 2:133710495-133710517 TGACATAAAAATAATGAATTTGG - Intergenic
938740693 2:134228895-134228917 ATCCATGAAAATAACCAGGTGGG - Intronic
938804743 2:134795788-134795810 AGGAATAAAAATAATGAACTCGG - Intergenic
938812948 2:134870514-134870536 AGCCTTGCAAATAATGATGTCGG - Intronic
938847748 2:135228604-135228626 AGCAATAAAGATAAAGTGGTTGG + Intronic
939139177 2:138333104-138333126 AGCCATAAAATTAAGGATGCTGG - Intergenic
940322979 2:152396885-152396907 AGCTTTAAAAATAATGATGAGGG - Intronic
940537564 2:154965836-154965858 TGCCATTAAATTAATGATGTAGG + Intergenic
940793418 2:158052028-158052050 AGCTACAAAAATATTTAGGTAGG + Intronic
942288824 2:174449542-174449564 AGCCATAAAAAGAATGAAATAGG + Intronic
943318234 2:186414659-186414681 ACCCAGAAACATAATGAAGTTGG - Intergenic
944295146 2:198053248-198053270 AGCCATGCAGATAATGAAGTGGG - Intronic
944966504 2:204940653-204940675 AGCTGTAAATATAAAGAGGTGGG + Intronic
945647088 2:212510911-212510933 AGTCATGAAAATAATGTCGTTGG - Intronic
945811616 2:214556316-214556338 AGCCAGAAAAACAATCAGTTTGG - Intronic
946210177 2:218141362-218141384 ATCTTTAAAAATAATGAAGTAGG + Intergenic
946595550 2:221302096-221302118 ATTCATAAAAATAATCAGATGGG - Intergenic
947560851 2:231150043-231150065 AGCCATAAAAAAAATTATATAGG + Intronic
948402721 2:237695144-237695166 AGACATAAATATAGTAAGGTAGG + Intronic
1170327093 20:15168684-15168706 AGCCATAAAAAGAATGAGCCAGG + Intronic
1170626615 20:18034923-18034945 AGCTATAATATTGATGAGGTGGG - Intronic
1171102863 20:22402231-22402253 TACCATAAAATTCATGAGGTAGG + Intergenic
1172318936 20:33981021-33981043 AGACATAAAACAAATGAGCTTGG - Intergenic
1173138287 20:40459486-40459508 TTCCATAAAACTAATGATGTGGG + Intergenic
1174183246 20:48688086-48688108 AGCCAAAAAAAAAATGGGGTGGG + Intronic
1174441845 20:50561922-50561944 AGGGAGAAAAATGATGAGGTTGG - Intronic
1174879372 20:54261603-54261625 AACCAAAAAAATAATAATGTAGG - Intergenic
1175582005 20:60107170-60107192 AAACTTAAAAAGAATGAGGTTGG - Intergenic
1176405310 21:6357765-6357787 AGCCTAAAAAATAATGAAATTGG - Intergenic
1176431847 21:6631338-6631360 AGCCTAAAAAATAATGAAATTGG + Intergenic
1177055033 21:16290912-16290934 AGCCATAAAAATCCTCAGCTGGG + Intergenic
1177190060 21:17840873-17840895 AACCATAAAGATAATGAGTGAGG + Intergenic
1177296215 21:19179729-19179751 AGCTATAAAAATAATGTGGATGG + Intergenic
1177496346 21:21896633-21896655 AGCCATTAAAAGAATGAAATAGG - Intergenic
1177547218 21:22574789-22574811 AGACACAAAAATAATGGGGAGGG + Intergenic
1177812349 21:25937928-25937950 AGTCAAAAAAATAATAAGCTGGG - Intronic
1178792940 21:35716960-35716982 AACCCTAAAAATATTGAGGTTGG + Intronic
1179042260 21:37814596-37814618 AGCCATAAAAAGAATGAGATCGG + Intronic
1181295393 22:21834237-21834259 AGGCATAAAAATTATGAAGCTGG + Intronic
1184831275 22:46990216-46990238 AACCGTATAAATAATTAGGTTGG - Intronic
949719014 3:6967078-6967100 AGTCAATAAAATACTGAGGTGGG - Intronic
950246545 3:11424941-11424963 ATCCATTAAAAGAATGAGGCAGG - Intronic
950833308 3:15896496-15896518 AGCTATAAGAATGCTGAGGTAGG + Intergenic
951544710 3:23812742-23812764 CACCATCAAAATAATGAGTTAGG - Intronic
952064227 3:29548269-29548291 AGCAATAAAAAAAATTAGCTGGG + Intronic
954738960 3:52731585-52731607 AGCCACATACATAATGAAGTTGG + Intronic
954815427 3:53276728-53276750 AGCTAAAAAAAAAATGAGGCAGG + Intergenic
954946560 3:54430335-54430357 AGTGTTAAAAATATTGAGGTTGG + Intronic
955144068 3:56298876-56298898 TGTCACAAAAATCATGAGGTGGG + Intronic
955646813 3:61148375-61148397 AGCCAGAAAAATAGGGAGCTAGG - Intronic
955906471 3:63813102-63813124 AGCCATTAAAAGAAGAAGGTTGG - Intergenic
956375963 3:68613798-68613820 AGCAATAAAATTAGTAAGGTAGG + Intergenic
957991223 3:87630235-87630257 AGCCCTAAAAGGGATGAGGTTGG - Intergenic
958431137 3:94043138-94043160 GGCCAAAAAAATAATGAATTTGG + Exonic
958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG + Intronic
959114070 3:102155494-102155516 AGCTTTAAAAAGAATGAGATTGG + Intronic
959970512 3:112404098-112404120 AGTTATAAAAATAAAGAGGTAGG - Intergenic
960229653 3:115210201-115210223 GGCCATCAAAATAAAGAGGGAGG - Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960569603 3:119172890-119172912 AGCCATTAAAATAATGTTCTGGG + Intronic
961024386 3:123540639-123540661 AACAATAAAAATAATAGGGTGGG - Intronic
961133224 3:124488067-124488089 AGCTATAAAGAAAGTGAGGTGGG - Intronic
961376745 3:126472140-126472162 AGCCATACAGGTAATGAGCTAGG - Exonic
963399652 3:144781641-144781663 AGACACAAAAGTATTGAGGTTGG + Intergenic
963524716 3:146403627-146403649 AGTCATAAAAATAATGAGACAGG - Intronic
964991048 3:162813078-162813100 AGTCAAAAAAATAACGATGTTGG - Intergenic
965064689 3:163831183-163831205 AGAAATAAAAATAATTAGCTGGG - Intergenic
965288460 3:166846068-166846090 AGCCATGAAAAGGATGAGATTGG - Intergenic
965604811 3:170487311-170487333 AACAATGAAAATACTGAGGTGGG - Intronic
965654356 3:170968156-170968178 AGCCATAAAAATGCACAGGTTGG + Intergenic
966382052 3:179354244-179354266 AGCCATAAATAGAAAGGGGTAGG + Intronic
967432974 3:189409537-189409559 AGCCTTAAAAATAATTACGTAGG - Intergenic
967846689 3:194048921-194048943 AGAGATTAAAATAATGAGGCAGG - Intergenic
968344283 3:197987568-197987590 AGCCAGAAAAAAAATGACTTAGG + Intronic
968740372 4:2326566-2326588 TTCCATAAAAAAAATGATGTTGG + Intronic
970607969 4:17699030-17699052 AAACATGAAAATAATGAGGAGGG + Intronic
970698507 4:18707309-18707331 AGGCATAAAAATAATCTGCTTGG - Intergenic
971401095 4:26275924-26275946 AGCCATAAAAACTATGATTTGGG - Intronic
971887210 4:32466130-32466152 AGCCATTAAAATAATAAGGTAGG - Intergenic
971903921 4:32700888-32700910 AGACATAAAAATACTAAGATAGG + Intergenic
971965847 4:33554794-33554816 AGCTATTAAAATAATGATGGTGG - Intergenic
972949227 4:44298412-44298434 ATACAGAAAAATAAAGAGGTGGG - Intronic
974083983 4:57239959-57239981 TGCCATAAAAACAATGAGCATGG - Intergenic
974227890 4:59071573-59071595 AGCCATGAAAATGATAAAGTAGG + Intergenic
974907914 4:68080006-68080028 ACCCATGAAAATAATCAGGCAGG + Intronic
974975694 4:68888396-68888418 ACCAATAAATATAATGATGTTGG - Intergenic
975278775 4:72535800-72535822 AGACAGCAAAAGAATGAGGTTGG + Intronic
975650419 4:76587422-76587444 ATCCTTGAAATTAATGAGGTGGG - Intronic
977136530 4:93311525-93311547 AGCAAGAAAAAAAATGAGGCAGG + Intronic
977152783 4:93533962-93533984 AGCCAGAAAGATAATGAGGTGGG - Intronic
978664973 4:111171849-111171871 AGTAACAAATATAATGAGGTTGG + Intergenic
979528488 4:121742705-121742727 AGCCATTAAAATTTTGAAGTAGG + Intergenic
980875273 4:138656064-138656086 TGGCATAAAAATTAGGAGGTAGG - Intergenic
981231618 4:142363000-142363022 AGCAACAAAAATAATGTGGAGGG + Intronic
981715396 4:147746906-147746928 AACCAGAAAAAGAATGTGGTGGG - Intronic
981819481 4:148869213-148869235 TGCTATAAAAATAAATAGGTAGG - Intergenic
981869321 4:149467807-149467829 AGGCAGAAGAATAATGAAGTTGG - Intergenic
982497518 4:156109434-156109456 AATTATATAAATAATGAGGTTGG + Intergenic
983787841 4:171757315-171757337 AGCCATAAACATATTCATGTTGG + Intergenic
984014571 4:174410601-174410623 AGGAATAAAAATAATTAGCTGGG + Intergenic
986591734 5:9377648-9377670 AGGCAAAGAAATAATTAGGTTGG + Intronic
986738631 5:10686048-10686070 AGACATAATAATAATGAAGATGG - Intronic
987187502 5:15439870-15439892 AGCTATAAAAATAACTAGATAGG - Intergenic
988085080 5:26464714-26464736 TTCCTTAAAAATAATGAGTTTGG + Intergenic
991339936 5:65597704-65597726 AGCCATTAAAAGAAAAAGGTTGG - Intronic
991361957 5:65830202-65830224 AGCCATTAGAAGAATGATGTGGG + Intronic
991613766 5:68475114-68475136 ATCTGTAAAAATAACGAGGTAGG - Intergenic
992298338 5:75350415-75350437 AATCTTAAAAATAATGAGATTGG - Intronic
992315664 5:75551274-75551296 AGCAATAAAAATAAAAAGATAGG + Intronic
993447410 5:88030572-88030594 AGGGGTAAAAATAATGGGGTAGG + Intergenic
993462849 5:88206287-88206309 AGTCATAAAAATTATGAGTAAGG + Intronic
993849090 5:92983501-92983523 AACCATAGAAATAATGATGATGG + Intergenic
993863322 5:93162356-93162378 AGCAACACAAATAAAGAGGTGGG - Intergenic
993962078 5:94310541-94310563 AGACATAAAAGTAATGTGGTGGG + Intronic
995745460 5:115397889-115397911 AGTCATAAAAATAAGGTGATGGG - Intergenic
996082369 5:119269781-119269803 CCCCATAAAAATAATTATGTAGG - Intronic
998413338 5:141927757-141927779 AGGCAAAAAGATAATGGGGTAGG - Intronic
998629165 5:143879326-143879348 ACCCATAAACATAAAGAGATTGG - Intergenic
1000437161 5:161226400-161226422 AGCATTAAAAAGAATGAGGGTGG + Intergenic
1001467813 5:171984029-171984051 AGACATAATAATAATGAGTGGGG + Intronic
1001868922 5:175133351-175133373 AGCCAGGAAGAAAATGAGGTGGG - Intergenic
1002387881 5:178882921-178882943 AGCCATAAAAATGTTGAATTTGG + Exonic
1002888508 6:1315656-1315678 AGCTCTACATATAATGAGGTGGG + Intergenic
1003750458 6:9049336-9049358 AATATTAAAAATAATGAGGTCGG - Intergenic
1004361823 6:14978028-14978050 CACTATAAGAATAATGAGGTTGG - Intergenic
1004875105 6:19943615-19943637 AGACATAAAAAAAATTATGTAGG - Intergenic
1005095358 6:22109043-22109065 AGCAAAAAAAATAATGATTTTGG - Intergenic
1008686735 6:53933537-53933559 AGCACTAAAAATAATGAAATTGG - Intronic
1008726891 6:54432313-54432335 ATCCATAAAAATGAGGAGTTAGG + Intergenic
1008831150 6:55764271-55764293 AGCCATAAAAAGAATGAAATTGG + Intronic
1010437476 6:75850353-75850375 TATCATAAATATAATGAGGTAGG + Intronic
1012270778 6:97207849-97207871 AGCCATATAAATGCAGAGGTTGG - Intronic
1012452050 6:99362985-99363007 AACCAGAAGAATAATGAGATTGG + Intergenic
1012821964 6:104096046-104096068 AGACATATTAAAAATGAGGTTGG - Intergenic
1013458862 6:110357268-110357290 AGCCAAGAAGTTAATGAGGTAGG + Intronic
1013744062 6:113323574-113323596 AGCCAAAAAAATAATAAGGAAGG - Intergenic
1014217099 6:118762747-118762769 AGCCATAAAAAGAATGAAATTGG - Intergenic
1015919854 6:138255748-138255770 AGCCATCAAAATAATGAAAGAGG + Exonic
1016163633 6:140911859-140911881 ATACTTAAAAATAATGAGGCAGG + Intergenic
1016888978 6:148986799-148986821 AGACATAAAAATGATGATGACGG - Intronic
1019130561 6:169870039-169870061 AGCCATAAAAATAAAAAGAGTGG - Intergenic
1021489144 7:21199510-21199532 AGCAATAAAAATAACGGTGTTGG + Intergenic
1021500189 7:21324154-21324176 AGACTTAAAAATAGTAAGGTAGG - Intergenic
1021987953 7:26115359-26115381 AGCCCTCAAAAAAGTGAGGTTGG - Intergenic
1022389685 7:29932724-29932746 AGACATACAAATAAGGAGGTGGG + Intronic
1023227258 7:37983692-37983714 AGAAAAAAAAATGATGAGGTGGG + Intronic
1023890618 7:44389376-44389398 AGCCATCAAAATAAGGAGGCCGG + Intronic
1024166555 7:46738867-46738889 AGTCATAGAAATTATGCGGTTGG - Intronic
1026157107 7:67836181-67836203 AGTCATTAAAATAATGATTTAGG + Intergenic
1027502886 7:78977128-78977150 AGCCAACAAAATAATGAAGAAGG + Intronic
1027788788 7:82613657-82613679 TGCCAAAAAAATGGTGAGGTGGG + Intergenic
1028174011 7:87631689-87631711 AGATATAAAAATAAAGAGGCCGG - Intronic
1028851598 7:95543866-95543888 TGCTATAAAAATTATAAGGTTGG - Intergenic
1029048540 7:97658211-97658233 AGTCATAAAAATAATTATGATGG - Intergenic
1029912620 7:104170889-104170911 AGAGGTAAAAATAATCAGGTAGG - Intronic
1030211239 7:106997919-106997941 AGCAATAAAAATGATTAGCTTGG + Intergenic
1031033244 7:116758007-116758029 AGCTATAACAATAAAGAGGGTGG - Intronic
1031780369 7:125953981-125954003 AGCCATAAAAAGGATGAAATCGG - Intergenic
1032684324 7:134216120-134216142 CCCCATAAAAATACTGAGGTAGG - Intronic
1033445133 7:141414383-141414405 AGCCATAAAAATGATGTTTTTGG - Intronic
1034058788 7:148067080-148067102 TGCCAGAAAAATAATTCGGTAGG - Intronic
1034152456 7:148927699-148927721 AGCCCTAAAAATAATTAGGTAGG - Intergenic
1035687555 8:1536779-1536801 GGAAATAAAAATAAAGAGGTGGG - Intronic
1035715709 8:1753229-1753251 CCTAATAAAAATAATGAGGTGGG - Intergenic
1037136503 8:15468937-15468959 TGACTTAAAAATAATGAGGGAGG + Intronic
1037650962 8:20838205-20838227 GGACATAAAAATTATGAGCTAGG + Intergenic
1037896998 8:22664115-22664137 AGCCACCAAAATCATGAGTTTGG + Intronic
1038321545 8:26531789-26531811 AGGCAGAAAAAAAATGAAGTAGG + Intronic
1041482590 8:58339506-58339528 AGCCATAAAAAGGAACAGGTTGG + Intergenic
1043078442 8:75732957-75732979 AACTATAGTAATAATGAGGTAGG - Intergenic
1043309005 8:78834891-78834913 AGCCATAAAAAAAAGCAGGTTGG - Intergenic
1043349731 8:79345523-79345545 AGACATGAAAATCAAGAGGTGGG + Intergenic
1044258010 8:90088611-90088633 AGCCTTAAAAAAAATGAGGTGGG - Intronic
1044994295 8:97823999-97824021 AACAATAAAAATAATGGGGCGGG - Intronic
1045464229 8:102454421-102454443 AACCTTAAAAATAATTAGCTGGG + Intergenic
1045615330 8:103902428-103902450 AGCCATGAATACCATGAGGTGGG + Intronic
1045746897 8:105432939-105432961 AAACATAAAAATAATTAGGTGGG + Intronic
1046565836 8:115899934-115899956 TGCTATAAAAATAAGGGGGTGGG - Intergenic
1047127202 8:121975762-121975784 AGGCATACAAGTAATGAGGGAGG - Intergenic
1048647087 8:136433919-136433941 AGTCATAAAAAGAATGAGACTGG + Intergenic
1048761166 8:137796953-137796975 AGACTAAAAAATAATGATGTGGG + Intergenic
1048935895 8:139356678-139356700 AGACTGAAAAATAATGATGTAGG - Intergenic
1050341454 9:4643702-4643724 AGCTATCAAAATAATGATGTAGG + Intronic
1050722365 9:8605187-8605209 AGACCTTAAAATAATGAAGTTGG + Intronic
1051187664 9:14477431-14477453 AACCATCCAAATAATGAGATTGG + Intergenic
1051688307 9:19681701-19681723 ATCCATAAAAATAAAGCAGTGGG + Intronic
1052135580 9:24905945-24905967 ACCCATAAAAATAATTTAGTTGG + Intergenic
1052967270 9:34349793-34349815 AGCCATAAAAAAAAATAGGATGG + Intergenic
1053331212 9:37209417-37209439 AGCCATGTAAATATTGAGGTTGG - Intronic
1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG + Intronic
1057021547 9:91701725-91701747 AGCCATAAAAATAAGGAACTAGG - Intronic
1057447978 9:95131999-95132021 AGCCATAAAGATTTTTAGGTAGG + Intronic
1058440472 9:105001981-105002003 GCCATTAAAAATAATGAGGTAGG + Intergenic
1059259106 9:112959020-112959042 TACCATAAAAATAATTTGGTAGG - Intergenic
1059634269 9:116156009-116156031 ATCCATAATAATAATGACGATGG + Intronic
1059999715 9:119947181-119947203 AGTGATAAAAATGCTGAGGTTGG + Intergenic
1060325343 9:122609194-122609216 TGTCTTAAAAATAATGATGTAGG + Intergenic
1061708568 9:132471569-132471591 TGCTATAAACATAATCAGGTAGG + Intronic
1203439692 Un_GL000195v1:177370-177392 AGCCTAAAAAATAATGAAATTGG - Intergenic
1186321724 X:8434664-8434686 AGCCAGAAAAATAATGAAATGGG + Intergenic
1186561576 X:10618952-10618974 AGACATTAAAAGTATGAGGTTGG + Intronic
1187227203 X:17384997-17385019 GGAAATAAAAATAATGAGGTAGG + Intronic
1188755546 X:33956664-33956686 AGCCTGAAAAATAATGTTGTAGG - Intergenic
1189620182 X:42828304-42828326 AGCAGTAAAAACAATGATGTGGG + Intergenic
1189671316 X:43413267-43413289 ATCAATTAAAATAAAGAGGTTGG - Intergenic
1189996123 X:46640125-46640147 AGCCATAACAATAAAGTGGGAGG + Intronic
1190528543 X:51352082-51352104 AGCAATAAAGATATTGGGGTGGG - Intergenic
1190761188 X:53439524-53439546 AGCCTTAAAAGTGAGGAGGTGGG - Intergenic
1191642549 X:63442947-63442969 AGCCCTCAAAATAATTAGATAGG + Intergenic
1191810947 X:65187628-65187650 ATCAATAAAAATATTTAGGTTGG - Intergenic
1193843475 X:86438525-86438547 ACCCATAAAAAGAATGAGTTCGG - Intronic
1194866611 X:99076815-99076837 AGCCATACAATGAGTGAGGTTGG - Intergenic
1196351514 X:114736331-114736353 AGCGCTAAAAATAAAGGGGTAGG + Intronic
1196604363 X:117639611-117639633 AACCTTAAAAATAATGACGTTGG + Intergenic
1197537236 X:127706257-127706279 AGCAAGAAATATAATGAAGTTGG + Intergenic
1197632753 X:128881042-128881064 ATCTATCAAAATAAGGAGGTTGG + Intergenic
1198201864 X:134429507-134429529 TGCCATAAAAATATGGAGATGGG + Intergenic
1201334527 Y:12865896-12865918 TGCATTTAAAATAATGAGGTTGG + Intergenic