ID: 960351682

View in Genome Browser
Species Human (GRCh38)
Location 3:116601314-116601336
Sequence CTCATAAGAAACCCTGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960351682_960351685 24 Left 960351682 3:116601314-116601336 CCACTTACAGGGTTTCTTATGAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 960351685 3:116601361-116601383 CATTAATGAGGCATTTCTACTGG 0: 1
1: 0
2: 2
3: 11
4: 133
960351682_960351684 12 Left 960351682 3:116601314-116601336 CCACTTACAGGGTTTCTTATGAG 0: 1
1: 0
2: 0
3: 15
4: 173
Right 960351684 3:116601349-116601371 TGCACAGAAGCACATTAATGAGG 0: 1
1: 0
2: 0
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960351682 Original CRISPR CTCATAAGAAACCCTGTAAG TGG (reversed) Intronic
901101621 1:6723513-6723535 CTCATAAGGACACCTGTCAGTGG - Intergenic
907591432 1:55676083-55676105 CTCAAAAGAAAACCTACAAGCGG - Intergenic
907635228 1:56127704-56127726 CTCAAAAGAAAACCTACAAGTGG + Intergenic
907893088 1:58654573-58654595 CCCACAAGAAGCCTTGTAAGTGG - Intergenic
908145766 1:61241281-61241303 CTCTTAAGAAACAATGTCAGAGG - Intronic
909824500 1:80110314-80110336 CTCAAAAGAAGACATGTAAGTGG - Intergenic
911836030 1:102620063-102620085 ATCATACCAAAACCTGTAAGAGG - Intergenic
913373426 1:118126156-118126178 CTCAAAAGAGAACATGTAAGTGG - Intronic
913501321 1:119475232-119475254 GTCAAAAGAAACACTGTCAGGGG + Intergenic
913512370 1:119573495-119573517 CTCAAAAGAAACACTGTCAGGGG + Intergenic
913516651 1:119611003-119611025 CTCAAAAGAAACACTGTCAGGGG + Intergenic
914758394 1:150579499-150579521 CTCAAAAGAAACGCGGTAATCGG - Exonic
915837156 1:159186832-159186854 GTCTTAAGAAACTGTGTAAGAGG - Intronic
917063710 1:171068622-171068644 CTAATAAGATACTCTGTAATAGG + Intergenic
919303024 1:195794480-195794502 CTCAGAACAAACCAGGTAAGTGG - Intergenic
919539640 1:198830928-198830950 CTCATCACACACCCTGCAAGAGG - Intergenic
921847502 1:219899561-219899583 CTCTTAAAAAATCCTGTATGTGG - Intronic
924080904 1:240397237-240397259 CTCAAAAGAAGACATGTAAGTGG - Intronic
1066516652 10:36169090-36169112 CTCATAAGAAGACTTGTAAATGG - Intergenic
1068321882 10:55429417-55429439 CTCATCAGAAACAGTGAAAGAGG - Intronic
1071939132 10:90568579-90568601 CTCAAAGGAAAACATGTAAGTGG - Intergenic
1079043872 11:17082674-17082696 CACAAAAGAAACCCGGTAACTGG + Intronic
1079549529 11:21676813-21676835 ATCAAAAGAAACACGGTAAGTGG - Intergenic
1080371543 11:31651512-31651534 CTCAAAAGAAACCATTGAAGTGG + Intronic
1080445010 11:32330709-32330731 CTCATAACAATCCCTTGAAGTGG + Intergenic
1081380851 11:42412885-42412907 CTAATAAGAAATCCTGTGAAAGG - Intergenic
1082040676 11:47682336-47682358 CTCATATTAAACACTCTAAGAGG - Intronic
1085028536 11:73255416-73255438 CTAATAAGTAACCCAGTCAGTGG + Intergenic
1085953714 11:81365213-81365235 CTAATAAGAAACCCTGTATATGG + Intergenic
1087985548 11:104675335-104675357 CTCAAAAGAAAACATATAAGCGG + Intergenic
1089654982 11:119940834-119940856 CTCCTGAGAAACACTGGAAGAGG - Intergenic
1089656657 11:119952255-119952277 CTCATAAGAACCCCAAGAAGAGG + Intergenic
1103141913 12:118556064-118556086 CTCATAACAAACCCAGGAAGTGG + Intergenic
1104876738 12:132040076-132040098 CTCAAAGGAAAACATGTAAGTGG + Intronic
1105733640 13:23245599-23245621 CTCCTAAGAAATTCAGTAAGGGG + Intronic
1106287866 13:28333825-28333847 CTCAGAAGAAACCTTGTAAATGG - Intronic
1106756445 13:32827106-32827128 CCAATAAGACACCCTGTAACAGG - Intergenic
1106879076 13:34109554-34109576 CACATAAGAGAGCTTGTAAGTGG - Intergenic
1107523604 13:41207537-41207559 CTCAAAAGAAGACCTATAAGTGG - Intergenic
1108468872 13:50747932-50747954 CTCAAAAGATGCCCTGTCAGGGG + Intronic
1115802695 14:37013359-37013381 GTCATAGCAAACCCAGTAAGAGG - Intronic
1117454671 14:55885110-55885132 CTCATGAGAAATCCTGTTAGAGG + Intergenic
1117888751 14:60394385-60394407 CTCAAAAGAAAACATGCAAGTGG - Intergenic
1118577153 14:67254032-67254054 ATCCTAAGAAAACTTGTAAGGGG - Intronic
1119244154 14:73089284-73089306 ATCATAAGCAACACTGTAGGCGG + Intronic
1119986977 14:79149161-79149183 CTGGTAGGAAACTCTGTAAGGGG + Intronic
1121575601 14:94982998-94983020 CTCAGCAGAAACCCTACAAGCGG + Intergenic
1121908533 14:97768738-97768760 GTCATAAGCATCCTTGTAAGAGG + Intergenic
1122395730 14:101428581-101428603 CTCATCTGAAACTCTGTAGGTGG - Intergenic
1125901125 15:43348853-43348875 CTCTTAAGAACCACTGAAAGAGG + Intronic
1126677277 15:51171446-51171468 TTTAAAAGGAACCCTGTAAGAGG + Intergenic
1127101263 15:55567147-55567169 CTCAAAAGAAGCCGTGCAAGTGG - Intronic
1127357943 15:58219099-58219121 CTCAAAAGTAAACATGTAAGCGG - Intronic
1127369412 15:58323545-58323567 CTCAGAAGAAGGCATGTAAGTGG - Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1131060800 15:89403451-89403473 CTCATGAGGAATCCTGTCAGAGG - Intergenic
1131686192 15:94770538-94770560 ACCATAGGAAACCCTTTAAGTGG - Intergenic
1133176724 16:4020931-4020953 TTCAAAAAAAACCCTATAAGTGG + Intronic
1135775739 16:25256596-25256618 CTAATAAAAGACCCTATAAGGGG - Intronic
1137477760 16:48825251-48825273 CACATAAGAAAACTTGTAATTGG - Intergenic
1144103630 17:11966267-11966289 CTCATCAGAAACCATGAAAGAGG + Intronic
1147509669 17:41056846-41056868 CCTATAAGAAACCATGCAAGTGG - Intergenic
1148941472 17:51216499-51216521 ATCATGAGAAACCCTTTAAAAGG - Intronic
1150947054 17:69759072-69759094 TTGATAAGAAACCATGAAAGTGG - Intergenic
1151992532 17:77585769-77585791 CTCAAAAGAAAACATATAAGCGG - Intergenic
1155758245 18:29529481-29529503 CTCATAACAATCCCTTAAAGTGG - Intergenic
1161117205 19:2504351-2504373 CTCATAAGAAAGACTAGAAGAGG + Intergenic
1167109369 19:47449966-47449988 CCCATAAGATACTCTGTAATGGG + Intronic
925850450 2:8076375-8076397 CTCAGAAGACCCCCTGTAGGGGG + Intergenic
928613701 2:33016044-33016066 CTCATACCAAACCCTGTCAGTGG + Intronic
928653261 2:33423731-33423753 CTCATAAGAACACCAGTAATTGG + Intergenic
928720731 2:34117666-34117688 CTCATCAGAAATTCTGAAAGTGG + Intergenic
930090465 2:47527954-47527976 CTGCTAAGAAACCCAGTGAGGGG - Intronic
930187386 2:48423637-48423659 CTCATTAGAAAGCACGTAAGTGG + Intergenic
931354441 2:61522417-61522439 CCCAAAAGATAACCTGTAAGTGG + Intronic
931879685 2:66555477-66555499 CTCAAAGGAAGCTCTGTAAGGGG + Intronic
932121213 2:69102390-69102412 CTCTTAAGAAATCCTTTCAGGGG + Intronic
933112760 2:78424872-78424894 ATCACAAGAATCCCTATAAGAGG - Intergenic
933362659 2:81307635-81307657 AGCATAAGAAAACTTGTAAGTGG - Intergenic
933574033 2:84046473-84046495 CTCATCAGAAATCATGTAACAGG + Intergenic
934608823 2:95719715-95719737 CTCTTGAGAACACCTGTAAGTGG - Intergenic
935744357 2:106177784-106177806 CTCATAAGCCACCCTGTCTGTGG + Intronic
936542119 2:113361182-113361204 CTCTTGAGAACACCTGTAAGTGG - Intergenic
937258524 2:120571115-120571137 CTCACAAGGAGCCCTGGAAGTGG + Intergenic
938076870 2:128344426-128344448 CTCATAAGAACCCTTAGAAGTGG - Intergenic
939624239 2:144457237-144457259 CTCATAACAAACCTTTGAAGGGG + Intronic
940200836 2:151148563-151148585 CTCATTAGAAGACGTGTAAGAGG + Intergenic
940436981 2:153667157-153667179 CTCATTGGCAACCCTGAAAGAGG + Intergenic
940806151 2:158188946-158188968 CTCAAAAGAAGACATGTAAGTGG + Intronic
942916243 2:181311257-181311279 CTAAAAAGAAAAGCTGTAAGTGG + Intergenic
943351712 2:186804596-186804618 CTCATTAGCATCCCTGAAAGAGG - Intergenic
943577019 2:189641785-189641807 GAGATAAGAAACCCTGGAAGAGG + Intergenic
943803241 2:192088924-192088946 CCCATAATTAACCCTGTAACTGG - Intronic
944863427 2:203837296-203837318 TTCATAAGAAACCATCAAAGTGG - Intergenic
946542598 2:220701392-220701414 CTCAACAGAAAACATGTAAGTGG - Intergenic
947277443 2:228408735-228408757 CTCAGTAAAAATCCTGTAAGAGG - Intergenic
947363806 2:229373303-229373325 CTTAAAAGAAAGCATGTAAGTGG + Intronic
1169483773 20:6009022-6009044 CTCTTAAGAAAACCTATAATAGG + Intronic
1174565834 20:51463904-51463926 CTCATAAGTAGCCCAGTAAAGGG + Intronic
1175696914 20:61109467-61109489 CTCATTAGAACCCCTGTTAAGGG + Intergenic
1175865393 20:62173330-62173352 CTCATAAGAAACCACGTGTGTGG - Intronic
1176363967 21:6021467-6021489 CTCGTAGGAAACCCTGAATGAGG + Intergenic
1179391869 21:41001035-41001057 TTCATCAGAAACCATGAAAGCGG - Intergenic
1179759551 21:43517078-43517100 CTCGTAGGAAACCCTGAATGAGG - Intergenic
1180136297 21:45863990-45864012 CTCAGAAGGAACCCTGTTAGTGG - Intronic
1180152422 21:45957074-45957096 CTCACAAGAAAACGTGTCAGTGG + Intergenic
1184804957 22:46788823-46788845 GTCATAACAAACCCTTCAAGGGG + Intronic
1185052833 22:48562778-48562800 CTCATGAGAAGCCGTGTCAGGGG - Intronic
950827610 3:15841640-15841662 CTCAAAAGAAAACATGTAAATGG + Intronic
959792868 3:110385637-110385659 CTTATAAGGAACCCTGTCATTGG - Intergenic
960351682 3:116601314-116601336 CTCATAAGAAACCCTGTAAGTGG - Intronic
961334945 3:126169539-126169561 CACATCAGAAACCCTGTACAGGG - Intronic
963875394 3:150469377-150469399 CCCATAAGGAACCCACTAAGAGG + Intergenic
964031105 3:152139767-152139789 CTCAGAGGAAACTCTGTATGGGG - Intergenic
964416378 3:156452426-156452448 TTCAAAAGAAACCCTCTTAGAGG - Intronic
964693236 3:159477569-159477591 CTCAGAAGAAAACATGCAAGTGG - Intronic
966219543 3:177536828-177536850 CTCATTAGTTACCATGTAAGGGG + Intergenic
966315279 3:178637754-178637776 CTCATAACAAACCCTGCATATGG + Intronic
971802025 4:31305086-31305108 TGCAAAAGAAACCTTGTAAGAGG - Intergenic
972214926 4:36886410-36886432 CTCAAAAGAAAACTTATAAGCGG - Intergenic
973978190 4:56283941-56283963 CTCAAAAGAAACCTTGAGAGAGG + Intronic
975040693 4:69742343-69742365 CTCATACCAAAACCTGGAAGAGG - Intronic
976520074 4:86016564-86016586 CTTATAAGAAAACATGTAAAGGG - Exonic
978397385 4:108295896-108295918 GTCATGTGAAACCCTGTGAGGGG + Intergenic
979002812 4:115247240-115247262 CTCATGAGAAAGACTGAAAGGGG - Intergenic
980267694 4:130540683-130540705 GTCCAAAGAAACCCTTTAAGAGG - Intergenic
982884400 4:160760134-160760156 CTCAAAAGAAGACATGTAAGTGG + Intergenic
983817800 4:172154184-172154206 CTAAAATGAAACCCTGTAAAGGG + Intronic
985352118 4:189075479-189075501 CTCATAAGAAGACATGTATGTGG + Intergenic
987996619 5:25290326-25290348 CTCAAAAGAAAACATGCAAGTGG + Intergenic
989598415 5:43179486-43179508 TTCATGACAAATCCTGTAAGAGG - Intronic
990084724 5:51961206-51961228 CTTATAAGAAGCGCTGTAAAGGG - Intergenic
994617887 5:102129141-102129163 CTCACAAGAAATGCTGAAAGTGG - Intergenic
994790150 5:104214380-104214402 CTCTTAACAAACCCTGCAAGGGG + Intergenic
996144773 5:119960753-119960775 CTCAAAAGAAACCATGCAAATGG + Intergenic
996773775 5:127112486-127112508 CTCAAAAGAAGACCTGTAAGTGG + Intergenic
997205453 5:132046067-132046089 ATCACAAGAATCCTTGTAAGAGG - Intergenic
997358539 5:133279871-133279893 CTCATAAGGACACCAGTAAGCGG - Intronic
999346761 5:150829474-150829496 CTCAAAAGAAGACCTCTAAGTGG + Intergenic
1000021577 5:157323185-157323207 CACTTAAGGCACCCTGTAAGCGG + Intronic
1000560813 5:162786705-162786727 TTCTTAAGAAACCTTGTTAGGGG + Intergenic
1000698400 5:164418346-164418368 CTCACAAAAAACTCTGTAACAGG - Intergenic
1000847363 5:166298459-166298481 TTCACAATAAAACCTGTAAGTGG - Intergenic
1001855296 5:175005336-175005358 CTGCTAAGAACCCCTGGAAGTGG + Intergenic
1002762362 6:211824-211846 CTCTTCAGGAACCCTGTTAGTGG + Intergenic
1004793649 6:19056931-19056953 CTCAAAAGAAGACATGTAAGTGG + Intergenic
1005423104 6:25673152-25673174 GTCATAAGAAACACTGACAGGGG - Intronic
1007026620 6:38582562-38582584 TTCATCAGAAACCCTTCAAGAGG - Intronic
1011325088 6:86141889-86141911 CTCATAAGAAACTCTATAAAAGG - Intergenic
1011327216 6:86162140-86162162 CTCATAAAAAACACTCTAAGAGG - Intergenic
1011938376 6:92811374-92811396 GTCAGATGCAACCCTGTAAGTGG - Intergenic
1014211175 6:118709780-118709802 CTGATAAGCAGCCCTGTCAGGGG - Intronic
1014349205 6:120318103-120318125 TTCATAAGTTACCCTGTATGTGG - Intergenic
1015177605 6:130328126-130328148 CTCATGTGAGACCCTGGAAGTGG + Intronic
1017430907 6:154369824-154369846 CTCACAAGGGTCCCTGTAAGAGG - Intronic
1017968856 6:159291504-159291526 TTCATACAAAATCCTGTAAGTGG - Intergenic
1018158996 6:161019211-161019233 CACAGAAGAAACCCTGTCACTGG + Intronic
1019018017 6:168894137-168894159 ATCATAAGAAAGCCAGTTAGAGG - Intergenic
1019595356 7:1855893-1855915 CTCATAAGCCACCCTGTCTGTGG - Intronic
1020426419 7:8071148-8071170 CCCATAACAAACCCTCTAAGTGG - Intronic
1020456993 7:8385208-8385230 CTGACAAGTAACCCTGTTAGTGG + Intergenic
1022829697 7:34053344-34053366 ATCATAAGAAACACTGGATGGGG - Intronic
1024762215 7:52612337-52612359 CTCAGAAGAAACCCTGCTTGTGG - Intergenic
1031566442 7:123303512-123303534 CTCAAAAGAAAACATGCAAGTGG + Intergenic
1034057932 7:148055973-148055995 CTCATGAGAAGCCATGTTAGAGG - Intronic
1037235236 8:16712287-16712309 GTCATAGCAAACCCAGTAAGAGG - Intergenic
1039737922 8:40352276-40352298 CTCAAAAGAAGACATGTAAGTGG - Intergenic
1043799769 8:84593514-84593536 TTCATATGATACCCTGTTAGAGG - Intronic
1044362383 8:91303029-91303051 CTCATAAGAAAGTCTTTTAGTGG + Intronic
1045142168 8:99298842-99298864 CTAAAAACAATCCCTGTAAGGGG - Intronic
1045496560 8:102714404-102714426 CTCATAAGAACACCTGTCATTGG + Intergenic
1046248582 8:111600206-111600228 ATCACAAGAATCCTTGTAAGAGG - Intergenic
1050924420 9:11245640-11245662 CTCAAAAGAAAACATGTATGTGG - Intergenic
1056946827 9:91004889-91004911 CTCATGTGAAACACTGCAAGTGG + Intergenic
1058543498 9:106036469-106036491 ATCATAAGAATCCCTTTAAAAGG - Intergenic
1058703573 9:107620723-107620745 TTCTTCAGACACCCTGTAAGTGG - Intergenic
1059984417 9:119808235-119808257 CTCATAATCAACCCTGAAATTGG - Intergenic
1186796793 X:13054544-13054566 CTCCTTAGCAACCCTGTGAGTGG + Intergenic
1188086120 X:25903829-25903851 CTCAGAAGAAAGCCCGTAAGGGG + Intergenic
1188902407 X:35750261-35750283 TTCATAAAAAAACCTGAAAGAGG - Intergenic
1189576576 X:42359871-42359893 TTCATAAATATCCCTGTAAGAGG - Intergenic
1190360516 X:49644686-49644708 CTCAGAGGAAACCCTGGAATGGG + Intergenic
1192680834 X:73252409-73252431 CTCACAAAAAAACCTGTAAAAGG - Intergenic
1193515940 X:82463659-82463681 CTCATCTGAAACCCTTTATGTGG + Intergenic
1195225483 X:102788191-102788213 TTGAGAAGAAATCCTGTAAGTGG - Intergenic
1196360626 X:114851794-114851816 CTTACAAGAAACCCTTTTAGTGG + Intronic
1197324108 X:125070314-125070336 CTCAAAAGAAAACATGCAAGTGG - Intergenic
1198059672 X:133032683-133032705 TTCATAAGTAACCGAGTAAGAGG + Intronic
1201695283 Y:16817903-16817925 CTCATCAGATGCCCTGTTAGGGG - Intergenic