ID: 960351849

View in Genome Browser
Species Human (GRCh38)
Location 3:116603415-116603437
Sequence CCCAGGATTCTGTATTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960351843_960351849 -5 Left 960351843 3:116603397-116603419 CCCACAAAAATCCCAGAACCCAG 0: 1
1: 0
2: 4
3: 37
4: 313
Right 960351849 3:116603415-116603437 CCCAGGATTCTGTATTCTCTTGG 0: 1
1: 0
2: 2
3: 21
4: 203
960351844_960351849 -6 Left 960351844 3:116603398-116603420 CCACAAAAATCCCAGAACCCAGG 0: 1
1: 0
2: 2
3: 28
4: 296
Right 960351849 3:116603415-116603437 CCCAGGATTCTGTATTCTCTTGG 0: 1
1: 0
2: 2
3: 21
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960351849 Original CRISPR CCCAGGATTCTGTATTCTCT TGG Intronic