ID: 960353412

View in Genome Browser
Species Human (GRCh38)
Location 3:116621339-116621361
Sequence GAGTTTTTTTTTTAACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 1, 2: 4, 3: 61, 4: 763}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960353412_960353413 -4 Left 960353412 3:116621339-116621361 CCTGGCAGTTAAAAAAAAAACTC 0: 1
1: 1
2: 4
3: 61
4: 763
Right 960353413 3:116621358-116621380 ACTCTTATGCCATTAACACAAGG 0: 1
1: 0
2: 2
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960353412 Original CRISPR GAGTTTTTTTTTTAACTGCC AGG (reversed) Intronic
900515030 1:3077644-3077666 GAGTTTTGTTTTTATCTCCTTGG + Intronic
900842739 1:5067977-5067999 CAGTTCTGTTTTTAATTGCCAGG - Intergenic
901753038 1:11423489-11423511 TAGTTTATTTTTTAAGTGCAGGG - Intergenic
901812025 1:11772849-11772871 GAGTTTCTTTTTTTGCTCCCTGG + Intronic
902318228 1:15640060-15640082 CAGTTTTTTTTTAAACTCCCAGG - Intronic
903074370 1:20751296-20751318 GATTTTTTTTTTTTACTGCACGG + Intronic
903437685 1:23364034-23364056 TAGTTTTTTTTTTAAGAGACAGG - Intronic
904135892 1:28312297-28312319 GTTTTTTTTTTTTAATTGGCTGG - Intergenic
904159050 1:28508913-28508935 GATTTTTTTTTTTAACAGGGAGG + Intronic
904529229 1:31157200-31157222 TTTTTTTTTTTTTAACGGCCAGG - Intergenic
904721420 1:32512150-32512172 AAGTTTTTTTTTTAAGAGGCAGG + Intronic
904956501 1:34288622-34288644 AATGTTTTTTTTTAATTGCCTGG + Intergenic
905497182 1:38401278-38401300 TATTTTTTTTTTTAATTTCCTGG - Intergenic
905600256 1:39244015-39244037 GAGATTTTTTTTTCCTTGCCTGG - Intronic
905848334 1:41253780-41253802 GAGGTTTTTTTTTTTCTGGCCGG + Intergenic
906362509 1:45175745-45175767 GTTTTTTTTTTTTAAAGGCCAGG - Intronic
906714565 1:47957144-47957166 GAGTTTTCTTTCTAACAGTCAGG - Intronic
906945976 1:50294602-50294624 GAAGTTTTTTTTTATGTGCCAGG - Intergenic
907209179 1:52804238-52804260 GACTTTTTTTTTTAAGAGACTGG - Intronic
907600933 1:55768571-55768593 GATTTTTTTTTTTTACTTCTGGG + Intergenic
907716025 1:56926839-56926861 GACTTTTTTTTATAAGTACCTGG + Intergenic
907901605 1:58746597-58746619 TATTTTTTTTTTTTTCTGCCTGG + Intergenic
907932133 1:59010345-59010367 TTTTTTTTTTTTTAACTGCAGGG + Intergenic
907940078 1:59079145-59079167 GAGTTTTCTTTTTTACTTACAGG - Intergenic
908059657 1:60333913-60333935 GTTTTTTTTTTTTAACTTCTTGG + Intergenic
908107887 1:60864678-60864700 AAATTTTTTTTTTAACTCCTTGG + Intergenic
908846857 1:68333693-68333715 TATTATTTTTTTTAATTGCCTGG - Intergenic
909259836 1:73473133-73473155 GAGTTTTTCTTTTAACTTATTGG - Intergenic
909261183 1:73491383-73491405 TAGTTTTTCTTCTAACAGCCAGG + Intergenic
909274609 1:73667720-73667742 TAGTTTTCTTTTTAACGGCCAGG + Intergenic
909762084 1:79302444-79302466 CATTTTTTTTTTTTCCTGCCTGG - Intergenic
909836890 1:80266974-80266996 GAGTTGGTTTTTCTACTGCCAGG - Intergenic
910384478 1:86666147-86666169 ATGTTTTGTTTTTAACTCCCTGG + Intergenic
910528125 1:88204377-88204399 GAGGTTGTTTTTTACCTCCCAGG - Intergenic
910556543 1:88540868-88540890 GATTTTTTTTTTTATTTGACTGG + Intergenic
910567401 1:88659990-88660012 GAGTTTGTTTTAAAATTGCCTGG - Intergenic
910581589 1:88832640-88832662 GTTTTTTCTTTTTCACTGCCTGG + Intronic
910838171 1:91536158-91536180 TATTTTTTTTTTTAAATGACAGG + Intergenic
910906589 1:92187971-92187993 AAATTTTTTTTTTAACTAGCTGG + Intergenic
911342263 1:96653222-96653244 GAGTGCTTTTTTTAACCACCGGG + Intergenic
911794616 1:102059560-102059582 TTGTTTTTCTTTTAACAGCCTGG - Intergenic
912595065 1:110867243-110867265 TTGTTTTTTTTTTTTCTGCCAGG - Intergenic
913199523 1:116484569-116484591 AAATTTTTTTTTTAATTGGCAGG + Intergenic
913669697 1:121084955-121084977 GAATTTTTATTTTAAGTTCCAGG + Intergenic
914021455 1:143872353-143872375 GAATTTTTATTTTAAGTTCCAGG + Intergenic
914659945 1:149780270-149780292 GAATTTTTATTTTAAGTTCCAGG + Intergenic
915714689 1:157933823-157933845 GGGATTTTTTTTTAATTACCTGG + Intergenic
916066576 1:161140953-161140975 AAATTTATTTTTTAACTTCCTGG - Intergenic
916656630 1:166882527-166882549 GATTTTTTTTTTTAAAGGCAAGG + Intergenic
916688371 1:167168316-167168338 GAGTTATTTTTTAAAGGGCCAGG + Intergenic
916696812 1:167245712-167245734 AAGTTTTTTTTTTAATTAGCTGG - Intronic
916796797 1:168175022-168175044 TTGTTTTTTTTTTAACAGACAGG - Intergenic
917072346 1:171165926-171165948 GGGTTTTTTTTTTAAGAGACAGG + Intergenic
917533634 1:175858383-175858405 GGGTTTTTTTTTTAATTGTATGG + Intergenic
917688322 1:177441289-177441311 GAGTTTTTTTTTTTCTTACCAGG + Intergenic
917909172 1:179623793-179623815 AAATTTTTTTTTTAATTGGCTGG - Intronic
918090783 1:181292350-181292372 GTGTTTTTTTTTCAGCTGCCTGG + Intergenic
918141227 1:181721615-181721637 TTTTTTTTTTTTTAACTCCCTGG + Intronic
918290757 1:183105626-183105648 CATTTTTTTTTTTAAATGCAAGG - Intronic
919051021 1:192511276-192511298 GAGTTTTTTTTTCAAAATCCAGG + Intergenic
919375767 1:196792520-196792542 TAATTTTTTTTTTAAGTTCCAGG - Intronic
919969606 1:202565893-202565915 GACTTTTTTTTTTTTTTGCCTGG - Intronic
920673962 1:208026091-208026113 TTGTTTTCTTTTTAATTGCCAGG + Exonic
920967391 1:210712370-210712392 GAGTTTTTATTTCAAGTACCAGG - Intronic
921250073 1:213289379-213289401 GACTTTTTGGTTTAATTGCCTGG + Intergenic
921310442 1:213837259-213837281 GATATTTGTTTTTAACTGCATGG + Intergenic
921569186 1:216758534-216758556 AATTTTTTTTTTTAACCTCCTGG + Intronic
921750921 1:218793456-218793478 GAGTTCCTTTTCTAGCTGCCGGG - Intergenic
922678629 1:227570672-227570694 GTTTTTTTTTTTTTACTGCAAGG + Intronic
922864778 1:228850600-228850622 GAGGTTGATTTTTAACTACCAGG + Intergenic
923071989 1:230574081-230574103 GGTTTTTTTTTTTAAGTGACAGG - Intergenic
923611779 1:235502420-235502442 GGGATTTTTTTTTAAGTTCCGGG - Intronic
923627413 1:235625253-235625275 GTTTATTTTTTTTAAATGCCGGG - Intronic
923753428 1:236768427-236768449 TTTTTTTTTTTTTAACTGACAGG + Intergenic
923782377 1:237036502-237036524 GAGTTCATTCTTTAACTGCAGGG - Intergenic
923978166 1:239288454-239288476 GTTTTTTTTTTTTTACTTCCTGG + Intergenic
924046519 1:240037611-240037633 GGGTTGATTTTTTAACTACCAGG + Intronic
924395641 1:243617406-243617428 CAGTTTTTTTTTTAAGTGAATGG - Intronic
1062869666 10:889125-889147 TAGTTTGTTTTTTAACTACTTGG - Intronic
1063332407 10:5174149-5174171 GAGTTTTTTTTTTAAGAACAGGG - Intergenic
1063719777 10:8568366-8568388 GACTTTTTTTTCCTACTGCCAGG + Intergenic
1063732606 10:8716047-8716069 TAGTTCTTTTTTTAAATGCTTGG + Intergenic
1065567059 10:27022450-27022472 GATTTTTTTTTTTAACTTTAGGG - Intronic
1065832369 10:29626470-29626492 GAGTTTATTAGTTCACTGCCAGG - Intronic
1066798614 10:39156474-39156496 GAGTTTTTTTAGAAACTGCAAGG + Intergenic
1067005628 10:42658776-42658798 GTGTTTTTTTTTTTTATGCCTGG - Intergenic
1067455653 10:46417831-46417853 GAGTTTGTTGTTTAACAGGCTGG - Intergenic
1067631550 10:47966808-47966830 GAGTTTGTTGTTTAACAGGCTGG + Intergenic
1067923230 10:50480985-50481007 GAGTTTTGTTTGTAAATCCCTGG - Intronic
1068303210 10:55173164-55173186 CACTTTTTTTTTTAACCTCCAGG + Intronic
1068534690 10:58229207-58229229 GAATTTTTTTTTTAAATACTAGG + Intronic
1068715305 10:60181131-60181153 GACTTTTGTCTTTAACGGCCTGG - Intronic
1069133933 10:64740673-64740695 AATTTTTTTTTTTGGCTGCCCGG + Intergenic
1069193643 10:65521206-65521228 GGATTTTTTTTTTAACTCTCTGG - Intergenic
1069312371 10:67054185-67054207 AAGTTTTTTTTTTAATAACCAGG - Intronic
1069515568 10:69074185-69074207 GTGTTTGTTTTTTAAATGCCAGG + Intergenic
1069875217 10:71558812-71558834 CAGTTTTCCTTTTTACTGCCTGG + Intronic
1069965789 10:72114842-72114864 AACTTTTTTTTTTAAAGGCCAGG + Intronic
1069968616 10:72144710-72144732 GAGTGTTTTTTTTAATTTCAAGG - Intronic
1070081519 10:73193248-73193270 TATTTTTTTTTTTAACAGCTGGG + Intronic
1071069288 10:81672649-81672671 GGTTTTTTTTTTTAATTGCTAGG + Intergenic
1071847226 10:89533824-89533846 GTTTTTTTTTTTTAACTGATGGG - Intronic
1072074624 10:91957550-91957572 GAAGTATTTTTTTTACTGCCTGG - Intronic
1072396812 10:95051550-95051572 GAGTTTTATTATTAAATTCCTGG - Intronic
1072910331 10:99495311-99495333 AGGGTTTTTTTTTCACTGCCTGG - Intergenic
1073169529 10:101491967-101491989 TTGTTTTTTTTTTAACTCCCTGG + Intronic
1073406946 10:103306637-103306659 GAGTTTTTACTGTAATTGCCAGG - Intronic
1074506545 10:114075883-114075905 AAGCCTTCTTTTTAACTGCCAGG + Intergenic
1074754222 10:116612508-116612530 TTTTTTTTTTTTTAACTCCCAGG - Intergenic
1075887479 10:125913858-125913880 GTGTTTTTGTGTAAACTGCCTGG - Intronic
1076933530 10:133551513-133551535 GATTTTTTTTTTAAAGTTCCAGG - Intronic
1077586182 11:3455183-3455205 GAGTTTTATTTTCTACTGGCTGG + Intergenic
1077710561 11:4532352-4532374 TAGTTTTCTTTCTAACTGTCAGG - Intergenic
1078529187 11:12123475-12123497 AAGTTTTTTTGTTAACAACCAGG + Intronic
1078935035 11:15942370-15942392 CAGTTTTGATTTTGACTGCCTGG - Intergenic
1078971282 11:16414555-16414577 GTGTTTTTTTTTAAACTTGCAGG - Intronic
1079204227 11:18399938-18399960 AAGATTTTGTTTTAAATGCCGGG + Intronic
1080183182 11:29447593-29447615 GAATTTTTTTTTTAATTCTCTGG + Intergenic
1080783004 11:35448859-35448881 CTGTTTTTCTTTTAACAGCCAGG + Intronic
1081086881 11:38812119-38812141 GAGTTTTCCTTCTAACAGCCAGG - Intergenic
1081136442 11:39445330-39445352 GAATTTTTTTTTTAATTCCAGGG + Intergenic
1081789527 11:45773167-45773189 CAGGTTTTTTTTTAACTGAGGGG + Intergenic
1081896988 11:46595241-46595263 TTTTTTTTTTTTTAAATGCCGGG + Intergenic
1081898591 11:46608604-46608626 AAATTTTTTTTTTAATTGCCAGG - Intronic
1081925611 11:46825961-46825983 GAGTTTTTTTTTTAATTTGAGGG - Intronic
1082980725 11:59117836-59117858 AAGTTTTTCTTTAAAATGCCAGG - Intronic
1083012449 11:59416104-59416126 CAGTTTTTATTTTAAGTTCCAGG - Intergenic
1085644025 11:78210945-78210967 CAGTTTATTTTTTAAGTTCCAGG + Intronic
1085755948 11:79201497-79201519 GAATTTTTTTTTTTTTTGCCTGG - Intronic
1086050481 11:82583221-82583243 GATTTTTTTTTTTTAATGGCAGG - Intergenic
1086817419 11:91390291-91390313 GAGTTTTGTTGGTATCTGCCAGG - Intergenic
1086822146 11:91446963-91446985 TAGTTTTTTTTTTAATTGCCTGG - Intergenic
1087173314 11:95073247-95073269 AAGTTTTTTTTATCTCTGCCAGG + Intergenic
1087191962 11:95264432-95264454 TTTTTTTTTTTTTAACTGCAAGG + Intergenic
1087353997 11:97071294-97071316 GATTTTTTTTTTTTATTGCTAGG + Intergenic
1087390084 11:97520578-97520600 AATTTTTTTTGTTAACTTCCTGG + Intergenic
1087411835 11:97800594-97800616 GAGTCTTTTTCTTTACTGCCTGG + Intergenic
1087490200 11:98815941-98815963 GAGTTTTTATTTTAAGTTCCGGG + Intergenic
1087542986 11:99544637-99544659 GAATTTTTTTTTTATCTGTGAGG + Intronic
1088160656 11:106865848-106865870 GAGTTTTGTTTTTAAATCCTGGG - Intronic
1088167922 11:106960229-106960251 GAATTTTTTTTTTAAATCTCAGG + Intronic
1088282016 11:108144697-108144719 CAGTTTTTTTTTTCATTGCGGGG - Intronic
1088495666 11:110429669-110429691 CAGTTTTTTTTTTAACGGCTAGG + Intergenic
1088530657 11:110805616-110805638 GATTTTTTTTTAAAACTGCAGGG - Intergenic
1088668281 11:112116640-112116662 GTGTTTTTTTTTTACTTGCATGG - Intronic
1088874687 11:113924686-113924708 GAGCTTTTTTTTCAGCTACCAGG + Intronic
1089055523 11:115581656-115581678 GAGTTTTTATTTTGTCTTCCTGG - Intergenic
1090756715 11:129798163-129798185 GAGTTTTGTGTTCAACTACCAGG - Intergenic
1091200928 11:133780591-133780613 GAGTTTTTTTTTTAATGTCTAGG + Intergenic
1091651060 12:2310333-2310355 TATTTTTTTTTTTAACTGGGAGG - Intronic
1092466362 12:8736274-8736296 GACTTTTCATTTTAACTGCTTGG - Intronic
1092750405 12:11713799-11713821 GAGGATTTTTTTAAACTCCCAGG - Intronic
1093042540 12:14400566-14400588 GAGATTTTTTTTTTAATTCCTGG + Intronic
1093086084 12:14868417-14868439 TTGTTTTTCTTTTAACAGCCTGG + Intronic
1093143768 12:15539916-15539938 GAATTTTTTTTTTTATTTCCTGG + Intronic
1093417092 12:18932183-18932205 GAGTTGTTTTTATAGCTGCCAGG - Intergenic
1093672615 12:21895779-21895801 GAGTTATTTTATTAACTGAAAGG - Intronic
1093836055 12:23830238-23830260 GAGTTTATTTTTTAAAGGTCAGG - Intronic
1093950407 12:25159288-25159310 GAGTATGTTTTTGACCTGCCAGG + Intronic
1094811684 12:34144392-34144414 GAGTTTTTTTTTTAACATGAAGG - Intergenic
1095545600 12:43364181-43364203 GTGTATTTTTTTTAATTACCTGG - Intronic
1097283062 12:57857510-57857532 GAGTTTTTTTTTTTTTTCCCGGG + Intergenic
1097912520 12:64985822-64985844 AAGTTTTTCTTTTAACAGACTGG + Intergenic
1097990292 12:65825742-65825764 GAGTTGCTTTTGCAACTGCCCGG + Intronic
1098372123 12:69770701-69770723 AAGTTTGATTTTTAACTGACAGG + Intronic
1099002198 12:77191882-77191904 GAGTCTTTATTCTAGCTGCCAGG + Intergenic
1100251528 12:92829815-92829837 CATTTTTTATTTTTACTGCCTGG - Intronic
1100834321 12:98551840-98551862 TTGTTTTTTTTTTATCTTCCAGG + Intergenic
1101142238 12:101808366-101808388 TTTTTTTTTTTTTAATTGCCCGG - Intronic
1101370890 12:104129295-104129317 GATTTTTTTTTTTAAGAGACAGG - Intronic
1101435055 12:104657510-104657532 GGTTTTTTTTTTCATCTGCCAGG - Intronic
1102110297 12:110360435-110360457 CAGTTTTTTTTTTAATTACAGGG + Intergenic
1102546113 12:113657024-113657046 GAGTTTTTTTTTTTTTTGCGGGG + Intergenic
1102756274 12:115343480-115343502 GAATTTTTTTTTTTTCTGCTGGG + Intergenic
1103863312 12:124031341-124031363 GGGTATTTTTTTTAAGTTCCGGG + Intronic
1104193400 12:126506413-126506435 AAGTTTTTTTTTTAAGTTCTGGG + Intergenic
1105558833 13:21471723-21471745 GAGTTTGATTATTAAATGCCTGG + Intergenic
1106283608 13:28299331-28299353 GATTTTTTTTTTTAATTTCCTGG + Intergenic
1106984380 13:35327902-35327924 GAGTTTTTTTTTTATATATCAGG - Intronic
1107024800 13:35789296-35789318 CAGTTTTTAGTTTAAATGCCTGG - Intronic
1107119343 13:36779607-36779629 TTGTTTTTCTTTTAACTGTCTGG - Intergenic
1107640565 13:42438997-42439019 GAGTGTTGTTTTAAGCTGCCAGG + Intergenic
1108538728 13:51415165-51415187 GAATTTTTTTTTTAAGTGAACGG - Intronic
1108765590 13:53625306-53625328 AAGTGTTTTTTTTTAATGCCAGG - Intergenic
1109066868 13:57706444-57706466 AAGTTTCTTTTTCAACAGCCTGG + Intronic
1109144909 13:58767484-58767506 GATTTTTTTTTTTATCAACCTGG - Intergenic
1109828345 13:67753462-67753484 TATTTTTTTTTTTAACTGACAGG + Intergenic
1110257151 13:73444941-73444963 AAGTTTTTTTTTTAACCAGCTGG + Intergenic
1110789334 13:79569865-79569887 GAGTTTATTTTGTTACTGCTGGG - Intergenic
1110879214 13:80550438-80550460 GTGTTTTTTTTTTATCAGCTGGG + Intergenic
1111023582 13:82488318-82488340 GTGTTTTTTTTTTAATTGTAAGG + Intergenic
1111173720 13:84564603-84564625 GAATTTTTTTTTTAACGACGGGG - Intergenic
1111429070 13:88128554-88128576 GAGTTTTTTTTTTAATTTAGAGG + Intergenic
1111484372 13:88876922-88876944 TAGTTTGTTCTTTAAGTGCCAGG + Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112322501 13:98420268-98420290 GAGTTTTGTCTCCAACTGCCAGG - Intronic
1112593522 13:100786709-100786731 CAGTTATGTTTTTATCTGCCTGG - Intergenic
1112990823 13:105512337-105512359 GATTTTTTTTTTTAATCTCCTGG - Intergenic
1114386727 14:22262811-22262833 GAATTTTTTTTTTAGCACCCTGG + Intergenic
1114506498 14:23218884-23218906 GAGTTTGATTATTAAATGCCCGG - Intronic
1114675746 14:24439183-24439205 GAGTTTTTTTTTTTCCTGATAGG + Exonic
1115208450 14:30940027-30940049 GTGTTTTTTTTTTAATTGCCTGG + Intronic
1115212406 14:30980906-30980928 AAGTTTTTTTTTTAATTCCTTGG - Intronic
1115357276 14:32461484-32461506 TAGTTTTTCTTCTAACAGCCAGG - Intronic
1116457755 14:45138719-45138741 TAGATTTTTTTTTAACAGCAAGG + Intronic
1116481965 14:45401942-45401964 CCGTTTTTTTTTTAAGTGCCTGG - Intergenic
1116576052 14:46577324-46577346 GATTTTTTTTTTTAACCACGGGG + Intergenic
1117369603 14:55064288-55064310 GATTTTTTTTTTTTCCTGGCTGG - Intronic
1117423912 14:55575975-55575997 GATTTTTTCTTTCAATTGCCAGG + Intronic
1117991453 14:61437922-61437944 GATTTTTTTTTTTAAGAGACAGG - Intronic
1118610357 14:67534494-67534516 CAATTTTTTTTTTAACAGACAGG - Intronic
1118852682 14:69596300-69596322 GAGTTATTTTTTATACAGCCAGG - Intergenic
1118967949 14:70605755-70605777 GGGTTATTTTTTTAATTTCCAGG + Intergenic
1119163672 14:72474607-72474629 GTGTTTTTTTTTTCTCAGCCAGG + Exonic
1119384657 14:74250248-74250270 AATTTTTTTTTTTAAATGCTAGG + Intronic
1119696274 14:76715669-76715691 GAGTTGTTTTTCTAACGTCCAGG - Intergenic
1120231002 14:81841305-81841327 GCTTTTTTTTTTTACCTGCAAGG + Intergenic
1121699770 14:95943808-95943830 GCCTTTTTTTTTTAAATGACTGG - Intergenic
1202870657 14_GL000225v1_random:160226-160248 GTGTTTTTGTGTAAACTGCCTGG + Intergenic
1123837529 15:24211202-24211224 AAGTATTTTTTTTGACAGCCTGG - Intergenic
1123865755 15:24518012-24518034 GTATTTTTTTTTTGACAGCCTGG - Intergenic
1124267168 15:28247164-28247186 GATTTTTTTTTTTAACAGACGGG + Intronic
1125053199 15:35326438-35326460 GAATTTTTTTTTTAAGAGACAGG + Intronic
1125536722 15:40444953-40444975 GGATTTTTTTTTTAATTGACGGG - Intronic
1125615226 15:41005504-41005526 TTTTTTTTTTTTTAAATGCCAGG - Intronic
1125626227 15:41111453-41111475 GAATTTTTTTTTTAATGGTCTGG + Intronic
1125989430 15:44091787-44091809 GAATTTTTTTTTTAACTGACAGG + Intronic
1126267525 15:46772366-46772388 AAGATTTTTTTTTAAATGCAGGG - Intergenic
1126468645 15:48983701-48983723 AAGTGTTTTTTTCAACCGCCTGG - Intergenic
1126551588 15:49936920-49936942 GATTTTTTTTTTTAATTTCCAGG + Intronic
1127119643 15:55760078-55760100 GATTTTTTTTTTTAAGAGACAGG + Intergenic
1127513579 15:59669362-59669384 GTGTTTTTTTTTTAAACTCCAGG - Exonic
1127532204 15:59854443-59854465 TTTTTTTTTTTTTAACTCCCGGG + Intergenic
1127967702 15:63935606-63935628 GATTTTTGTTTTTTTCTGCCTGG + Intronic
1128906964 15:71475920-71475942 GAATTTTTTTTTTAATAGACAGG - Intronic
1129138030 15:73571699-73571721 GAGTCTGTTTTTTCCCTGCCGGG - Intronic
1129190129 15:73932384-73932406 AAATTTTTTTTTTAAATGCATGG - Intronic
1129338329 15:74867750-74867772 GAGATTATCTTTTAACTGCAAGG + Intronic
1129643194 15:77404018-77404040 AAGTTCTGTTTTTAACTACCAGG - Intronic
1129943887 15:79522630-79522652 CATTTTTTTTTTTTACTGGCTGG - Intergenic
1130433288 15:83871148-83871170 AAGTTTGTTTTTTAACTGTTAGG - Intronic
1130760319 15:86812928-86812950 GATTTTTTTTTTTCACTGGAAGG + Intronic
1130823964 15:87524793-87524815 GACTTTTTTTTTCCACTTCCAGG - Intergenic
1131049721 15:89338715-89338737 GAATTTTTTTTAAAACTGGCTGG + Intergenic
1131564547 15:93473885-93473907 GAATTTATTTTAAAACTGCCTGG - Intergenic
1131721553 15:95174143-95174165 GAGCTTTTTTTTTAAATTTCAGG + Intergenic
1131835839 15:96390158-96390180 AAGATTATTTTTTAACTCCCGGG + Intergenic
1132435526 15:101798522-101798544 GCTTTTATTTTTTAACTGTCTGG + Intergenic
1133330761 16:4972028-4972050 TTTTTTTTTTTTTAATTGCCCGG + Intronic
1133549808 16:6843338-6843360 GAATTTTTTTTTTTCCTCCCTGG - Intronic
1133875925 16:9734245-9734267 GAATCTTATTTTTAAATGCCCGG - Intergenic
1134019804 16:10913634-10913656 GAGTTTTATTTTTAACTGTGAGG - Intronic
1134019857 16:10913980-10914002 GAGTTTTTTTTTTAACCATGAGG - Intronic
1134775807 16:16852488-16852510 TTTTTTTTTTTTTAACAGCCAGG + Intergenic
1135390579 16:22089887-22089909 GATTTTTTTTTTAATCTGTCTGG + Intergenic
1136538038 16:30911849-30911871 GTGTTTTTTTTTTAAGAGACAGG + Intergenic
1137232290 16:46577775-46577797 GATTTTTTTTTTTAAGAGACAGG + Intergenic
1137751622 16:50865549-50865571 TAATTTTTTTTTTAAGAGCCGGG + Intergenic
1137879104 16:52028010-52028032 GAGTTAGTTTTTTAATTGCCTGG + Intronic
1138046212 16:53728231-53728253 GACTTTTTTTTTTAAGAGACAGG - Intronic
1138499716 16:57432567-57432589 GAGTTTTTTCTTTTATTGCTTGG - Intronic
1138775452 16:59717675-59717697 TAATTTTTTTTTTAACAGTCTGG - Intronic
1139398939 16:66664643-66664665 TAGTTTTTTTTTTAAGTGTTTGG - Intronic
1139502508 16:67378840-67378862 GATTGTTTCTGTTAACTGCCAGG - Intronic
1139735350 16:68982947-68982969 GTGTTTTTTTTTTAAATACTTGG + Intronic
1140025569 16:71287593-71287615 CAATTTTTTTTTTAACTAACTGG - Intronic
1140118737 16:72065333-72065355 GAATTTCTTTTTTATCTGTCTGG - Intronic
1140594572 16:76393680-76393702 CAATTTTTTTTTTTTCTGCCAGG - Intronic
1140693447 16:77507685-77507707 GAATTTTTTCTTTAAGTCCCAGG - Intergenic
1140879088 16:79181556-79181578 GGGTTTTTTTTTTAATTGGCTGG + Intronic
1141385437 16:83618822-83618844 CATTTTTTTTTTTAACTCACAGG - Intronic
1141729393 16:85811526-85811548 CAGTTTTTTTTTTAAGAGACAGG - Intergenic
1141935555 16:87235892-87235914 GTGTTTTGATTTTAACTCCCGGG - Intronic
1203139836 16_KI270728v1_random:1755207-1755229 TATTTTTTTTTTTAACTTCTAGG + Intergenic
1142897286 17:2989664-2989686 GATTTTTTTTTTTAACTGTTGGG + Intronic
1143309176 17:5974132-5974154 GAGTTATTTTTTTTATTGCATGG - Intronic
1144012651 17:11164133-11164155 TAGTTTTTCTTCTAACTGTCTGG - Intergenic
1144805224 17:17961411-17961433 TAATTTTTTTTTTAATTGGCTGG + Intronic
1145005476 17:19335325-19335347 GATTTTTTTCTTTAACTTTCAGG - Exonic
1145727121 17:27140207-27140229 GAGTTTTTTTTTAATCTGTAAGG + Intergenic
1145857263 17:28172725-28172747 GATTTTTTTTTTTAACATCAAGG + Intronic
1146120932 17:30193801-30193823 GGGTTTTTTTCTAAACTGCAAGG - Intergenic
1146313732 17:31791076-31791098 GTTTTTTTTTTTTGCCTGCCAGG - Intergenic
1147234064 17:39044209-39044231 GACTTTGATTGTTAACTGCCTGG - Intergenic
1147298964 17:39508653-39508675 AATTTTTTTTTTTAAGTTCCAGG - Intronic
1147619715 17:41857650-41857672 GAGTTTTTATTTTAAGAGACAGG + Intronic
1148190262 17:45673543-45673565 GCGTTTTTTTTTTAATTTTCTGG + Intergenic
1149327028 17:55542400-55542422 GATTTTTTTTTATCACCGCCAGG + Intergenic
1149399664 17:56282721-56282743 GACTTTTTTTTTTGAAGGCCTGG + Intronic
1149416606 17:56466577-56466599 TAGTTTTTTTCTTAATTCCCGGG + Intronic
1150065832 17:62108437-62108459 GTGTTTTTTTTTTAAGAGACGGG - Intergenic
1150137826 17:62705187-62705209 GGGTTGGTTTTTTTACTGCCAGG - Intronic
1150269447 17:63853761-63853783 GAGTTTTTTTTTTTAATACAGGG - Intergenic
1150884099 17:69065468-69065490 GAATTTTTTTTTTAATTATCTGG + Intergenic
1152900978 17:82940949-82940971 GATTTTTTTTTTTAACAGAAAGG - Intronic
1154128896 18:11718110-11718132 AACTTTTTTTTTAAACTGCTAGG - Intronic
1154144664 18:11857124-11857146 GATTTTTTTTTTTAACATCTGGG - Intronic
1154184065 18:12166086-12166108 GAGTTTGGTTATTAAATGCCTGG + Intergenic
1155124243 18:22855519-22855541 GATTTTTATTTTTATGTGCCTGG + Intronic
1155156823 18:23164448-23164470 GTATTTTTTTTTTAAGTGTCTGG + Intronic
1155305520 18:24474378-24474400 AAGTTTTCTTTTTAACTGTAGGG - Intronic
1155455108 18:26003825-26003847 GACTTTTTTTTTTAATTGAGGGG + Intergenic
1155649575 18:28124943-28124965 GAGTTATTTTTTAAACTGTGTGG + Intronic
1156225256 18:35099452-35099474 AAAATTTTTTTTTAATTGCCAGG + Intronic
1156394917 18:36690723-36690745 AAGTTTTTTTTTTATATGGCGGG - Intronic
1156999068 18:43502688-43502710 ATGTTTTGTTTTTAAGTGCCTGG - Intergenic
1157458960 18:47867298-47867320 AAGTTTTTTTTTTAAATAGCTGG - Intronic
1157653903 18:49365792-49365814 GATTTGATTTTTTAACTTCCAGG + Intronic
1157969521 18:52250157-52250179 GATTTTTTTTTTAGACTGACTGG - Intergenic
1157970457 18:52261663-52261685 GATTTTTGTTTTTTAATGCCAGG + Intergenic
1158764884 18:60437757-60437779 AAGGTTTTCTTTTAACTGACTGG + Intergenic
1158820555 18:61153847-61153869 GAGTTCTTTTACTAACTACCTGG - Intergenic
1159280997 18:66285410-66285432 GATTATTTTTTTTTTCTGCCAGG - Intergenic
1159449982 18:68588584-68588606 GAGTTTTTTTTAAAAGTTCCTGG + Intergenic
1159571820 18:70123027-70123049 TAATTTTTTTTTTAAATGCCAGG - Intronic
1159745152 18:72224787-72224809 GAGTTTTCTTTTTAATTCTCAGG + Intergenic
1160085750 18:75776270-75776292 GTGTTTTTTTTTAATCTGCCTGG + Intergenic
1160974771 19:1787407-1787429 GAGTTTTTGTTTTAATTGGATGG + Intronic
1161395887 19:4044701-4044723 GTGTTTTTTTTTTAACTGCCTGG - Exonic
1162409263 19:10495160-10495182 GAGTTTATTTTTTAAGAGACAGG + Intronic
1162891924 19:13739740-13739762 GAATTTTTTTTTTAAGTTCTGGG + Intronic
1163277089 19:16291664-16291686 GATTTTTTTTTTTAAGAGACAGG + Intergenic
1163909874 19:20179631-20179653 GGCTTTTTTTTTTAAATCCCAGG - Intronic
1164197106 19:22978767-22978789 TAGTTTTTCTTTTAACAGTCAGG - Intronic
1165555193 19:36624891-36624913 GATTTTTTTTTTTCACAGACGGG - Intronic
1165799447 19:38538643-38538665 TAGATTTATTTTTAAATGCCAGG - Intronic
1166938593 19:46349847-46349869 TTGTTTTTTTTTTCCCTGCCTGG - Intronic
1168157159 19:54481041-54481063 TTTTTTTTTTTTTAACTGCCAGG + Intergenic
1168590645 19:57631803-57631825 TAATTTTTTTTTTAACTAGCCGG + Intronic
925241669 2:2336480-2336502 GGCTTTTTTTTTTAACTTCAGGG - Intergenic
925716955 2:6792812-6792834 GATGCTTTTCTTTAACTGCCAGG - Intergenic
925726700 2:6879672-6879694 CAGTTTTTTTTTTTAATGTCTGG + Intronic
926118507 2:10228289-10228311 GACTTTTTGTTTTGACAGCCTGG + Intergenic
926395859 2:12441454-12441476 GATTTTTTTTTTTAAGTACTTGG - Intergenic
926622101 2:15056093-15056115 GTTTTTTTTTTTTTACTTCCAGG - Intergenic
927052734 2:19346910-19346932 TAGGTTGTTTTTTAACTCCCTGG + Intergenic
927135532 2:20093765-20093787 GAGATTTTTTTTTTTCTCCCAGG - Intergenic
927815967 2:26217743-26217765 GAATTTTTTTTTTAATTAGCTGG + Intronic
928182459 2:29079075-29079097 GAGTTTTTTTTTTAAAGGGTAGG + Intergenic
928601842 2:32911100-32911122 GAGTGTTTTGTCTAACTGTCTGG - Intergenic
928627807 2:33158722-33158744 GAGTTTATATTTTAAATTCCAGG - Intronic
928927192 2:36592274-36592296 GAATTTTTTTTTTAAGTTCCGGG + Intronic
928959953 2:36913988-36914010 GATTTTTTTTTTTAAGAGACAGG + Intronic
929127774 2:38536457-38536479 CTTTTTTTTTTTTAACTGTCCGG - Intergenic
929440618 2:41963564-41963586 GAGTTCTTTTTTAAACTGCCTGG + Intergenic
929478123 2:42274201-42274223 GAGTTTTATATTTAACTGAAAGG - Intronic
929513964 2:42589448-42589470 GTGTTATTTATTTAGCTGCCTGG - Intronic
929616707 2:43315624-43315646 GAATTTTTTTTTTAATTAGCTGG - Intronic
929659328 2:43768481-43768503 GTGTATTTTTTTTAATTGGCAGG - Intergenic
929748605 2:44685887-44685909 GATTTTTTTTTTTAACTCTGAGG + Intronic
929958256 2:46477246-46477268 TAGTTTTCTTTTTAACAGTCAGG + Intronic
930127173 2:47810508-47810530 TAGTTTCTTATTTAACTGCATGG + Intronic
930365351 2:50432683-50432705 GTCATTTTTTTCTAACTGCCTGG + Intronic
930371589 2:50508407-50508429 GAGTTTTTTTTTTTTCATCCTGG - Intronic
930408847 2:50997667-50997689 AATTTTTTTTTTTAATTACCTGG - Intronic
930451919 2:51551468-51551490 TAGTTTTTTTTTTACATGCATGG + Intergenic
930811194 2:55543064-55543086 ATTTTTTTTTTTTAACTGGCAGG + Intronic
930817075 2:55609174-55609196 GATTTTTTTTTTTAAAAGGCTGG + Intronic
932045952 2:68350067-68350089 AATTTTTTTTTTTAAGTTCCAGG - Intergenic
932175569 2:69597719-69597741 AATTTTTTTTTTAAACAGCCAGG + Intronic
932450939 2:71810474-71810496 TAGTATTTTTTTTAAATGCAAGG - Intergenic
932634958 2:73380090-73380112 GATTTTTTTCTATAACTGACAGG + Intergenic
932785792 2:74602349-74602371 GAGATTTGTTTTTAATGGCCAGG - Intronic
934905322 2:98196006-98196028 GTGTTTTTTCTTTCTCTGCCTGG - Intronic
935026716 2:99284118-99284140 GAATTTTATTTTTCACTGACTGG - Intronic
935132689 2:100272597-100272619 AAGTATTTTTATTAACTTCCTGG - Intergenic
935478887 2:103560618-103560640 ATGTTTTTTTCTTATCTGCCTGG + Intergenic
935597387 2:104889907-104889929 AAGTTTTTTTTTTCACTCACTGG + Intergenic
935859622 2:107314563-107314585 GAGTTAATTTTTTCAGTGCCTGG - Intergenic
936470453 2:112793892-112793914 GAGCTTGTTTTTCAACTTCCAGG + Intergenic
936558645 2:113517602-113517624 GAGGTTTATTTTTAATTGCTAGG - Intergenic
936808490 2:116366991-116367013 AAGTTTTTTTTTCAACTGCATGG + Intergenic
936928029 2:117758093-117758115 GAGCTATTTTTTTAATAGCCAGG - Intergenic
938964644 2:136377479-136377501 AAATTTTTTTTTTAAATGGCAGG + Intergenic
939129565 2:138218170-138218192 GAATTTTATTACTAACTGCCAGG - Intergenic
939209378 2:139153102-139153124 TAATTTTTTTTTTAACTTCAGGG - Intergenic
939692691 2:145285266-145285288 TAGTTTTTTTTTTAATTTCATGG - Intergenic
940030443 2:149256878-149256900 TAGTTTTTCTTCTAACTGTCCGG + Intergenic
941221864 2:162791973-162791995 GAGTTTTTTTTTTAACATGAAGG + Intronic
941605741 2:167594536-167594558 GAGTGTTTTTTTAAACTTTCTGG + Intergenic
941660647 2:168192404-168192426 GAGAATTTTTTTTAAAAGCCTGG - Intronic
941757996 2:169208957-169208979 TAGTAATTTTTTTAAATGCCTGG - Intronic
942654626 2:178202525-178202547 AAGATTTCTTTTTATCTGCCGGG + Intronic
942678675 2:178454064-178454086 TATTTTTTCTTTTAATTGCCCGG + Intronic
942747352 2:179250168-179250190 GGATTTTTTTTTTAACTGTTGGG - Intronic
943240268 2:185376240-185376262 TAGTTTTTCTTCTAACAGCCAGG + Intergenic
943306754 2:186272198-186272220 TTTTTTTTTTTTTAACTGCGAGG - Intergenic
943781148 2:191825462-191825484 AATTTTTTTTTTTAAGTGACAGG + Intergenic
944262456 2:197692741-197692763 TAGTTTTTCTTTTAACAGACAGG + Intergenic
944699559 2:202234635-202234657 GTGTTTTTTTTTTTTTTGCCAGG + Intronic
945751498 2:213791246-213791268 GAATTTATTTTTTCACTGCAAGG - Intronic
945835275 2:214832493-214832515 TCTTTTTTTCTTTAACTGCCAGG - Intergenic
946540962 2:220684219-220684241 ACGTTATTTTTTTAACTGACAGG - Intergenic
946811077 2:223526370-223526392 GGGTTTCCTTGTTAACTGCCTGG + Intergenic
946883350 2:224198070-224198092 GACTTATATTTTTAATTGCCAGG - Intergenic
947197185 2:227580094-227580116 GTGTTTTTTTTTGAATTCCCAGG - Intergenic
947222398 2:227806012-227806034 TACTTTTTTTTTTAACTCCTAGG + Intergenic
947327615 2:228994780-228994802 TAGTTGTATTTTTAAGTGCCTGG - Intronic
947708899 2:232298675-232298697 TAATTTTTTTTTTAACTACAAGG - Intronic
947798348 2:232908748-232908770 TTGTTTTTTTTTTCATTGCCAGG + Intronic
948260345 2:236599841-236599863 AATTTTTATTTTTAAGTGCCGGG + Intergenic
1169460891 20:5794034-5794056 GATTTTTTTTTTTAAGTGAGGGG - Intronic
1170670792 20:18431223-18431245 GATTTTTTTTTTTTTCTGCCGGG - Intronic
1171016939 20:21550397-21550419 GAGTGTGTTTTTGACCTGCCAGG - Intergenic
1171059520 20:21942947-21942969 GAGTATCTTTTTTATCTGCTGGG - Intergenic
1171077481 20:22143274-22143296 GACTTTTTTTTTTAACAGAGAGG + Intergenic
1172084401 20:32369076-32369098 GGGTTGTTTTATAAACTGCCTGG + Exonic
1172287348 20:33750112-33750134 AAATTTTTTTTTTAAATCCCAGG - Intronic
1172558587 20:35865793-35865815 GGGTTTGGTTTTTAAGTGCCAGG - Intronic
1173065173 20:39703723-39703745 GATTTTTTTTTTTAACATACAGG - Intergenic
1173065513 20:39706802-39706824 GTGGTTTCTTTTTAACTGCATGG + Intergenic
1174105442 20:48159000-48159022 GGGTTTTTTTTTTCACAGCCAGG + Intergenic
1174543966 20:51311268-51311290 GTTTTTTTTTTTTAATAGCCAGG - Intergenic
1174665758 20:52256338-52256360 GAGTCTTTTTTTTAAGTTCCTGG - Intergenic
1175330068 20:58157555-58157577 GAGTGCTTTTTTAAACTGCATGG - Intronic
1175360538 20:58407661-58407683 TTGTTTTTTTTTTAACTCCCCGG + Intronic
1175390238 20:58622504-58622526 GAGGTTTTTTGTTAACCTCCGGG - Intergenic
1176043075 20:63076166-63076188 GACTATTTTTTTTAAGAGCCAGG - Intergenic
1176379173 21:6103222-6103244 GAGTTTCATTTTTAACTGCATGG + Intergenic
1176724768 21:10421999-10422021 ACTTTTTTTTTTTAAATGCCTGG - Intergenic
1176951770 21:15055928-15055950 CATCTTTTTTTTTAATTGCCAGG - Intronic
1176987558 21:15455592-15455614 TTGTTTTTCTTTTAACAGCCAGG + Intergenic
1177056312 21:16307401-16307423 GATTTTTTTTTTAAACTTTCTGG + Intergenic
1177401229 21:20607429-20607451 GAGTTTGATTATTAAGTGCCTGG - Intergenic
1177533417 21:22394063-22394085 GAGTTTTTTTTTTTTATTCCTGG - Intergenic
1179505706 21:41838892-41838914 CAGTTTTTCTTTTTACTGTCTGG - Intronic
1179744300 21:43435015-43435037 GAGTTTCATTTTTAACTGCATGG - Intergenic
1179803162 21:43821517-43821539 GAATTTTTTTTTTAAGTGATGGG + Intergenic
1180847018 22:18989057-18989079 AAGTTTTTTTTTAAATTACCTGG + Intergenic
1181819666 22:25466037-25466059 GTATTTTTTTTTTAATTTCCAGG + Intergenic
1182046676 22:27279652-27279674 GTGTGTTTTTTTTAATTGCTGGG + Intergenic
1183068778 22:35381771-35381793 TATTTTTTTTTTTAACTCCTGGG + Intronic
1183787380 22:40037877-40037899 AAGTTTTTTTTTTAATTAGCTGG - Exonic
1183966356 22:41445186-41445208 CAGTTTTTTTCTTCTCTGCCTGG - Intronic
1184057715 22:42063474-42063496 TACTTTTTTTTTTAACTCCTAGG - Intronic
1184845340 22:47080525-47080547 GAGATTTTTTTTTAACCGAATGG + Intronic
1184913462 22:47551068-47551090 GAGATTGTTTTCTAACTCCCGGG + Intergenic
949267774 3:2179657-2179679 CAGTGTTTTTTTTAATTTCCAGG + Intronic
949288467 3:2434566-2434588 GAGTTTGTTTTGTAATTTCCGGG + Intronic
949662357 3:6293424-6293446 GTGTTTTTTGTTTCACTCCCAGG - Intergenic
949756801 3:7421532-7421554 GAGATTTTTTTTTAAAGCCCAGG + Intronic
949845425 3:8365486-8365508 GATTTTTTTTTTTAACTTGGGGG + Intergenic
950027072 3:9827401-9827423 CAGATTTTTTTTTAACAGACAGG + Intronic
950079090 3:10208453-10208475 AAGATTTTTTTTTAATAGCCAGG - Intronic
950701214 3:14749696-14749718 GATTTTTTTTTTTTACTGTATGG + Intronic
951300355 3:20989015-20989037 GATTTTTTTTTTTAAGTTCTAGG + Intergenic
951354922 3:21654089-21654111 AAGTTTTTTTTTTAAATGGAAGG - Intronic
952009883 3:28888632-28888654 GTGTTTTTTTTTTAAGTTCTGGG + Intergenic
952181100 3:30917502-30917524 GAGGTTCTTGTTAAACTGCCAGG + Intergenic
952281193 3:31925065-31925087 GAGTTTTTTTGGTGACAGCCAGG - Intronic
952744037 3:36761498-36761520 GAATGTTTTTGTTAACTGCTTGG - Intergenic
952857928 3:37787622-37787644 AAGATTTTTTTTTTCCTGCCAGG - Intronic
952966904 3:38626677-38626699 GTTTTTTTTTTTAAACTCCCTGG - Intronic
953111136 3:39939413-39939435 GCTTTATTTTTTTAACTGCATGG - Intronic
953247033 3:41202707-41202729 GAGTATTTATTTTAACCGACTGG - Intronic
953264379 3:41371554-41371576 TAGTTTTTCTTTTAACAGTCAGG - Intronic
953674180 3:44986876-44986898 CAGTTTATCTTTAAACTGCCTGG - Intronic
953930493 3:47003488-47003510 GAGTTGCTCTTTTAACAGCCAGG + Intronic
954177372 3:48855263-48855285 CAGATTTTTTTTTAATAGCCAGG + Intergenic
954531190 3:51321235-51321257 TAGTTTTTCTTCTAACTGTCAGG - Intronic
954771523 3:52974191-52974213 GAATTTTCTTGCTAACTGCCTGG - Intronic
955076263 3:55616633-55616655 TTTTTTTTTTTTTAAGTGCCAGG + Intronic
955130932 3:56167762-56167784 GAAGTCTTTTTTTAACAGCCTGG - Intronic
955794343 3:62620074-62620096 GATTTTTTTTTTTAACTCTTGGG + Intronic
957147117 3:76438973-76438995 GGGTTTTTTTTTACACTTCCTGG + Intronic
957371840 3:79304341-79304363 TAGTATTTTTTTTAACTGAAAGG - Intronic
957494411 3:80972673-80972695 GACTTTTTTTTTTAAGTGTGTGG - Intergenic
957673167 3:83331868-83331890 GAATTTTTTATCTAACTGGCTGG - Intergenic
958474855 3:94568442-94568464 GGTTTTTCTTTTTTACTGCCTGG - Intergenic
959445773 3:106437327-106437349 AAGTTTTATTTTTAAATGACAGG + Intergenic
960353412 3:116621339-116621361 GAGTTTTTTTTTTAACTGCCAGG - Intronic
960569802 3:119174894-119174916 TTTTTTTTTTTTTAACTGCTGGG + Intronic
960886143 3:122397202-122397224 GATTTTTTTTTTTAACAGCAAGG + Intronic
961289641 3:125835439-125835461 GAGTTTCTTTTTTAATATCCGGG - Intergenic
963043554 3:141086329-141086351 GAGTTTATGTTCAAACTGCCTGG + Intronic
963394120 3:144710024-144710046 CAGCTTTTATTTTAACTTCCAGG - Intergenic
963479164 3:145847538-145847560 GTTTTTTTTTATTGACTGCCAGG + Intergenic
963546227 3:146661787-146661809 GTGTTTTTTTTTTTAGTACCTGG - Intergenic
963781483 3:149491147-149491169 GATTTTTTTTTTTAATTAGCTGG + Intronic
963950781 3:151198093-151198115 GAGTTATTCATTTAAATGCCTGG - Exonic
964241229 3:154597056-154597078 AGGGTTTTTTTTTAACTTCCAGG + Intergenic
964488216 3:157207601-157207623 TATTTTTTTTTTTTACAGCCTGG - Intergenic
964575654 3:158164279-158164301 TAGCTTTATTATTAACTGCCAGG + Intronic
964609987 3:158602568-158602590 GATCTATTTTTTCAACTGCCTGG - Intronic
964986347 3:162745055-162745077 GAGGTTTCTTTTTCAGTGCCTGG + Intergenic
965119141 3:164528863-164528885 CAGTTTTTATTTTAGCTTCCGGG + Intergenic
965191813 3:165540297-165540319 GAGTGTTTTTTTAAGCTGCTAGG + Intergenic
965997325 3:174899870-174899892 GAACTTTTTTTTTTACTGTCAGG - Intronic
966612754 3:181884282-181884304 TTGTTTGTTTTTGAACTGCCTGG - Intergenic
967536647 3:190612309-190612331 AACTTTTTTTTTTAACTGGAAGG - Intronic
967667080 3:192185539-192185561 GAATTTTTTTTTTAATTGAAAGG + Intronic
968145687 3:196296918-196296940 TTGTTTTTTTTTTAAGAGCCAGG - Intronic
968145732 3:196297172-196297194 GAATTTTTTTTTTAAGAGCCAGG - Intronic
968333755 3:197895049-197895071 GATTTTTTTTTTTAAGAGACTGG - Intronic
968395811 4:236595-236617 CAGTTTTTTTTGTAATTTCCAGG + Intergenic
969281698 4:6175030-6175052 GAGTTTGGTTTTTACCTGCAGGG - Intronic
969740952 4:9026154-9026176 GAATTTTTTTTTAATCAGCCTGG - Intergenic
970017466 4:11528740-11528762 GAGATATTTTTTTAAATGCCAGG - Intergenic
970168358 4:13263495-13263517 GTGTTTTGTTTTTAACAGCATGG - Intergenic
970483404 4:16500497-16500519 GTGTTTGTTTATTAAGTGCCAGG - Intergenic
970989133 4:22192171-22192193 CAGCGTTTTTTTTAACAGCCTGG + Intergenic
971729251 4:30355504-30355526 GATTTTTTTTTTCTACTGCCAGG + Intergenic
972768429 4:42173141-42173163 AGGCTTTTTTTTTAAATGCCAGG + Intergenic
972877275 4:43378021-43378043 GAATTTTTTTTTTAAGTTCTAGG - Intergenic
973263109 4:48184752-48184774 GTGTATTTTTTTTGTCTGCCTGG - Intronic
973739763 4:53908488-53908510 GGGTTTTATCTTTAACTCCCTGG + Intronic
973951258 4:56016679-56016701 GAGTTTTTTTTTTAAGAGTCAGG + Intronic
974336772 4:60558015-60558037 GTGTTTTTTATTTAACTGATTGG - Intergenic
974516546 4:62921203-62921225 TAATTTTATTTTTAACTTCCTGG - Intergenic
974762339 4:66293765-66293787 GAATTTCTTTTTTAAGTGCCAGG + Intergenic
975158087 4:71094009-71094031 CACTTTTTTTTTTAACAGTCTGG - Intergenic
975310850 4:72902156-72902178 GTATTTTTTTTTTAACTTTCTGG - Intergenic
975406812 4:73999419-73999441 AAGATTTTTGTTTAACTACCTGG - Intergenic
975483416 4:74907217-74907239 GAGGTTTTTTTTTATGTTCCAGG - Intergenic
975558406 4:75687104-75687126 TATTTTTTTTTTTAACTGGCAGG + Intronic
975626937 4:76359816-76359838 GATTTTTCTTTTCAACTGCATGG - Intronic
975791113 4:77952056-77952078 TAGTTTGTTTTTGAACTGCACGG + Intronic
976226712 4:82799804-82799826 GAGTTCTAGTTTTAACTGGCTGG + Intergenic
976412121 4:84726779-84726801 TGGTTTTTTTTTTAAGTGCATGG - Intronic
977322922 4:95542188-95542210 GAGTTCTTATTTTAAATACCAGG - Intronic
977410864 4:96661040-96661062 TAGTTATTTTTTTAACTCACTGG + Intergenic
977668830 4:99671732-99671754 TTGTTTTTCTTTTAACAGCCAGG - Intergenic
978691095 4:111511627-111511649 GATTTTTTTTTTTAAAGACCAGG + Intergenic
979285778 4:118922856-118922878 GATTTTATTTTTTAACAGACTGG - Intronic
979569087 4:122194876-122194898 GAGTGTTTTTTTTAAAGTCCGGG - Intronic
979660122 4:123243726-123243748 GAATTTTTTTTTTAATTACAGGG - Intronic
979663914 4:123289862-123289884 CACTTTTTTTTTTAAGTTCCAGG + Intronic
980333515 4:131440250-131440272 TTGTTTTTCTTTTAACTGTCTGG + Intergenic
980561278 4:134479836-134479858 TTTTTTTTTTTTTAAGTGCCAGG + Intergenic
980728936 4:136802658-136802680 GAGTTATTTTTTTAATTAGCCGG + Intergenic
980734379 4:136866432-136866454 TAGTTTTTTTATTAACTGGAAGG + Intergenic
981084113 4:140665836-140665858 AAATTTTTTTTTTAACTAGCTGG - Intronic
981090542 4:140727797-140727819 CCTTTTTTTTTTTAACTTCCTGG - Intronic
981257402 4:142678283-142678305 GATTTGTTTTGTTAACTGGCAGG - Intronic
981305585 4:143243771-143243793 TAGTTTTTTTTTTAATTGATGGG + Intergenic
981433172 4:144686296-144686318 GGATTTTTTTTTTAAGAGCCAGG + Intronic
981447078 4:144852257-144852279 GACTTTTGATTTTTACTGCCTGG - Intergenic
981854914 4:149277836-149277858 GAGTTTTTTTTTTAATCTTCTGG + Intergenic
982498264 4:156119344-156119366 GTTTTTTTTTTTTAAATTCCTGG - Intergenic
982601718 4:157459613-157459635 GTGCTTTCTTTTTTACTGCCTGG + Intergenic
982748106 4:159126593-159126615 GAATTTTCTTTTTAACTTACTGG + Intronic
983845932 4:172517587-172517609 GAGTTTTCTTTTTAAATTCCAGG - Intronic
984049526 4:174846568-174846590 TAGATTTTTTTTAAACTTCCAGG + Intronic
984482908 4:180328706-180328728 TAATTTTTTTTTCAACTGGCAGG - Intergenic
985113518 4:186569658-186569680 AAATTTTTTTTTTAAGTGCAGGG + Intergenic
985219468 4:187688303-187688325 GAGTATTTTTTTTAACCAACTGG - Intergenic
985310604 4:188594011-188594033 GGGTTTTGTTTTTAGCTGCACGG - Intergenic
986011786 5:3723950-3723972 TTGTTTTTCTTTTAACAGCCAGG + Intergenic
986361822 5:6985983-6986005 TATTTTTTTTTTAATCTGCCTGG - Intergenic
986459633 5:7957160-7957182 ACATTTTTTTTTTAAATGCCTGG + Intergenic
987072706 5:14352889-14352911 TTTTTTTTTTTTTAACTACCAGG + Intronic
987251207 5:16103104-16103126 TTGTTTTTTTTTTTTCTGCCTGG - Intronic
987484859 5:18512571-18512593 GACTTTTTTTTTTAATTAGCTGG + Intergenic
987831165 5:23096945-23096967 AAGATTTTTTTTTAAGTGCAAGG - Intergenic
988287934 5:29245549-29245571 CAATTTTTTTTTTAAATACCTGG + Intergenic
988449430 5:31326018-31326040 AGGTTTTTTTTTTAATTGCTAGG + Exonic
989017286 5:36953287-36953309 GAGTTTGTTTCTTAACTGCTAGG - Intronic
989356619 5:40550619-40550641 GACTTTTTTTTTTTTCTGACTGG + Intergenic
989416661 5:41185658-41185680 GACTTTTTTTTTAAAGTGCCAGG - Intronic
989446874 5:41540547-41540569 AAATTTTTTTTTTATCTGACTGG + Intergenic
990209404 5:53466255-53466277 GAGTTTTTTTTTTAAATCTAAGG - Intergenic
990237680 5:53785047-53785069 TTTTTTTTTTTTTAACTGCATGG + Intergenic
990433527 5:55763006-55763028 GAGTTTTTCTTTTAAGTTGCAGG + Intronic
990738969 5:58893034-58893056 AAGATTTTTTTTTAAGTTCCAGG - Intergenic
991340572 5:65603961-65603983 GCTTTTTTTTTTTAAGTGACGGG + Intronic
991393783 5:66181423-66181445 GACTTCTTTTTTTAAATCCCAGG + Exonic
991422063 5:66452059-66452081 TTGTGTTTTCTTTAACTGCCAGG - Intergenic
992810840 5:80386915-80386937 GAGTTTTATTCTAAAATGCCAGG + Intergenic
992891480 5:81208332-81208354 GTGTTTTGTTTTGAACTTCCAGG + Exonic
993241002 5:85385267-85385289 GGTTTTTTTTTTTAACTACTAGG + Intergenic
994079098 5:95686431-95686453 TAGTTTTTTTTTTAACTTGGAGG - Intronic
994091969 5:95817715-95817737 GGGCTTTTTTCTTCACTGCCAGG - Intronic
994971146 5:106739736-106739758 GAGTTTTTTTTTTATGGTCCAGG + Intergenic
995314859 5:110757988-110758010 GAGTTATTTATATAAGTGCCCGG + Intronic
995378511 5:111505899-111505921 GCGATTTTTTTTTAACTTTCCGG - Intronic
995752145 5:115463527-115463549 GAGATTTTTTTTTTACTCCTGGG - Intergenic
996092906 5:119368366-119368388 GGTTTTTTTTTTTAACAGACAGG - Intronic
996380879 5:122861553-122861575 GATTTTTTTTTTAACCTTCCTGG + Intronic
996698785 5:126427917-126427939 TAATTTTTTTTTTAATTTCCAGG + Intronic
996855453 5:128000792-128000814 GATTTTTTTTTTTAGCTGCTAGG + Intergenic
997027097 5:130077400-130077422 GAATTTATTTTTCAATTGCCTGG + Intronic
997193159 5:131959025-131959047 GACTTTTTTTTTTTTCTGCAAGG - Intronic
997205309 5:132044798-132044820 AAGTTTTTTTTTTAACATTCTGG - Intergenic
997844058 5:137269906-137269928 GATTTTTTTTTTTAAAAGCCTGG - Intronic
998353793 5:141517837-141517859 GAGTTTCTGTTCTAACTGCTGGG + Intronic
998690732 5:144584684-144584706 GACTTTTTTTTTTGACACCCAGG + Intergenic
998981902 5:147713153-147713175 CAGATTTTTTTTTAACTTCAAGG + Intronic
999071327 5:148746781-148746803 TTTTTTTTTTTTTGACTGCCAGG - Intergenic
999358572 5:150961327-150961349 AACTTTTTTTTTTAAGTGTCAGG - Intergenic
999397360 5:151238550-151238572 AAGTTTTATTTTTAGCTGCTGGG - Intronic
999885427 5:155917807-155917829 TTCTTTTTTTTTTAACTTCCAGG + Intronic
1000220105 5:159207495-159207517 AATTTTTTTTTTTAACTGGTTGG - Intronic
1000341973 5:160284871-160284893 AACTTTTTTTTTTAATTGCTTGG + Intronic
1001443526 5:171764338-171764360 AAGTCTGGTTTTTAACTGCCAGG - Intergenic
1001871370 5:175158887-175158909 GAGTTTCTTTCCTAAGTGCCTGG - Intergenic
1001936739 5:175710768-175710790 GGTTTTATTTTTTAACTTCCTGG + Intergenic
1003548662 6:7082972-7082994 GATTTTTTTCTTTCATTGCCAGG + Intergenic
1003849237 6:10204861-10204883 GAGTTTCTTTTTCAAATGACTGG + Intronic
1003911829 6:10750171-10750193 CTATTTTTTTTTTAACTGCCTGG + Intronic
1004729432 6:18343418-18343440 GAGTTTTTTATTTACATTCCTGG + Intergenic
1005041456 6:21603981-21604003 GAGTGTTTTTTTTAAAGGGCAGG + Intergenic
1005424658 6:25689750-25689772 GACTTTTTTTTTTGACTCCTTGG + Intronic
1005557442 6:27001607-27001629 GATTTTTTTTTTTAATTTGCAGG - Intergenic
1005720112 6:28593377-28593399 GAGTTTTTTTTTTTTTTGCTGGG + Intronic
1006125419 6:31834833-31834855 TAGTTGTTTTCTTATCTGCCTGG - Exonic
1006283386 6:33074832-33074854 CAGTTTTTTTAGTAACTGCCTGG - Intronic
1006763657 6:36485908-36485930 GACTTTTTTTTTTAAGAGACAGG + Intronic
1007399575 6:41596202-41596224 CAGTTTCTGTTTAAACTGCCAGG - Intronic
1007911277 6:45517185-45517207 GATTTTTTTTTTTAAGAGACAGG + Intronic
1008082752 6:47210657-47210679 CTGTTTTTCTTTTAACTGTCAGG - Intergenic
1008232924 6:49007192-49007214 GCTTTTTTTTTTTAACTTTCTGG + Intergenic
1008414629 6:51225267-51225289 TAGTTTTTCTTTTAACAGTCAGG - Intergenic
1008625930 6:53316504-53316526 GAGTTTGTTTTTAAACTGGGGGG + Intronic
1009438119 6:63641661-63641683 GAGTTTTGTTTTTGTCTTCCAGG + Intronic
1009651803 6:66485795-66485817 GAGTTTTTTGTTTGACTTCTTGG + Intergenic
1009775989 6:68206518-68206540 TAGTTTTCTTTCTAACTGTCAGG - Intergenic
1010242930 6:73633538-73633560 AAGTTTTTAATTTTACTGCCTGG + Intronic
1010267202 6:73880232-73880254 TATTTTTATTTTTAATTGCCTGG - Intergenic
1010743931 6:79539502-79539524 GAGTTTTATTTTTAATATCCTGG + Intergenic
1011232422 6:85178009-85178031 GAGTTTTATTCTTAAATGCCTGG + Intergenic
1011560725 6:88611913-88611935 GACTTCTTTTTTTAAATGCCAGG - Exonic
1012276018 6:97276668-97276690 CAGTTTTATTTTTTTCTGCCTGG + Intronic
1012287789 6:97414401-97414423 GAGTTTTTTTTTTAAATATTAGG - Intergenic
1012731741 6:102892017-102892039 GATTTTTTTTTCTAACTGTTTGG + Intergenic
1013044614 6:106471794-106471816 TTTTTTTTTTTTTAACTGTCTGG - Intergenic
1013453107 6:110304075-110304097 TAGTTTTTTTTCTAACAGTCAGG - Intronic
1013749511 6:113386972-113386994 AAATTTTTTTTTTAATTGGCAGG - Intergenic
1013876840 6:114841661-114841683 AAGTTTTTTTTTTAAATTTCTGG - Intergenic
1014049526 6:116935896-116935918 TAATTTTTTTTTTAAGTTCCAGG - Intergenic
1014120316 6:117717722-117717744 AATTTTTTTTTTTAATTTCCAGG + Intergenic
1014321543 6:119935494-119935516 GAGTTTCTTTTATAAATGTCAGG + Intergenic
1014471705 6:121823351-121823373 GAGTTGTTTTCTTAGCTGCTGGG - Intergenic
1014571347 6:123012490-123012512 GTGTTTTTTTTTTAATTTCTTGG - Intronic
1014868329 6:126559355-126559377 TAGTTTTTCTTTTAACAGTCTGG - Intergenic
1014878609 6:126693210-126693232 TAACTTTTTTTTTAACTACCAGG - Intergenic
1015461295 6:133494688-133494710 GTGTTTTTTTTTTAATTAGCTGG + Intronic
1015960927 6:138648825-138648847 AATTTTTTTTTTTAACTTCTGGG + Intronic
1015974154 6:138772784-138772806 GTTTTTTTTTTTTAAATGGCGGG + Intronic
1016423689 6:143912468-143912490 TTGTTTTTCTTTTAACAGCCTGG + Intronic
1016681426 6:146833556-146833578 GAGTTCTTTGTTTCCCTGCCTGG - Intergenic
1016847860 6:148587132-148587154 TTGTTTTTCTTTTAACTGTCAGG + Intergenic
1016848959 6:148597184-148597206 AAGTTTTTCTTTTAACAGACAGG - Intergenic
1017158663 6:151344834-151344856 TAGTTTTTTATTTAACTTTCTGG + Intronic
1017322508 6:153110471-153110493 GGGTTTTGTTTTTAGCTACCAGG + Intronic
1018300367 6:162396125-162396147 GAGCTTTTGTTTTCACTTCCAGG + Intronic
1018642622 6:165918200-165918222 GACTTTATTTTTTAAGAGCCAGG + Intronic
1019851184 7:3559473-3559495 CAAATTTTTTTTTAAGTGCCAGG + Intronic
1020517838 7:9146393-9146415 GTGTTTTTCTTTTAATTGCAAGG + Intergenic
1020819867 7:12953825-12953847 GACTTTTTCTTTTAAATGCCAGG - Intergenic
1020913865 7:14167485-14167507 GATATTTTTTTTTTACTCCCAGG - Intronic
1020920977 7:14263947-14263969 AAGATTTTTTTCTAAATGCCAGG - Intronic
1020979852 7:15053632-15053654 GGGTTTTTCTTTTCACTGCAAGG + Intergenic
1021125707 7:16849647-16849669 GAGTTTTTTTTTTTTCTTTCTGG + Intergenic
1021361921 7:19725681-19725703 AAGTTTTCTTTGTGACTGCCCGG + Exonic
1021564462 7:22003303-22003325 GATTTTTTTTTAAATCTGCCAGG - Intergenic
1021898182 7:25257195-25257217 GAATTTTTTTTATTACTACCAGG + Intergenic
1022067082 7:26869618-26869640 GACTTTTTTTTTTCAGTGCCAGG - Intronic
1022284722 7:28944924-28944946 GAATTTTTTTTTTATTTGACAGG - Intergenic
1022613584 7:31904471-31904493 GATTTTTTTTTTTAAGTGAGTGG - Intronic
1022802263 7:33787891-33787913 GAGATTGTTTTTTATCTGCAGGG + Intergenic
1023172787 7:37405700-37405722 CAGTCTGTATTTTAACTGCCAGG - Intronic
1023383988 7:39636571-39636593 GACTTTTTGTTTGAACTTCCAGG + Intronic
1023922862 7:44643145-44643167 GAGTTTTGTTTTTAACAGATGGG + Intronic
1024146791 7:46524948-46524970 GTGTTTTTTTTTTATCTTCTTGG + Intergenic
1024795220 7:53012233-53012255 GTGTTTTTCTTTTAACAGTCAGG + Intergenic
1025637829 7:63339351-63339373 GAGTTTTTCTTCTAACAGTCAGG + Intergenic
1025644868 7:63408748-63408770 GAGTTTTTCTTCTAACAGTCAGG - Intergenic
1025767844 7:64473878-64473900 CAATTTTTTTTTTACTTGCCTGG + Intergenic
1026330584 7:69348931-69348953 GGTTTTGTTTTTTAACTTCCTGG + Intergenic
1026378780 7:69778390-69778412 GGGTTTTTTTTTAAACTCCCTGG - Intronic
1026577661 7:71586679-71586701 GTTTTTTTTTTTTAATTGCATGG + Intronic
1026703540 7:72669592-72669614 GATTTTTTTTTTTAAGAGGCAGG - Intronic
1026737900 7:72960502-72960524 TAATTTTTTTTTTAACAGACAGG + Intronic
1027105834 7:75404566-75404588 TAATTTTTTTTTTAACAGACAGG - Intronic
1027864458 7:83629018-83629040 GAGTTTTCTTTCTAACAGTCAGG + Intronic
1028145785 7:87318751-87318773 TAGTTTTTCTTCTAACAGCCAGG + Intergenic
1028373909 7:90124712-90124734 TGGTTTTTCTTTTAACTTCCAGG + Intergenic
1028458452 7:91063897-91063919 GAGTGTTTTTTTTATGTGTCAGG + Intronic
1029379574 7:100204284-100204306 GTATTTTTTTTTTAACTGACTGG + Intronic
1029618747 7:101676801-101676823 CAGATTTTTTTTTAACCGTCTGG - Intergenic
1029855471 7:103511690-103511712 TAATTTTTTTTTTAACAGTCAGG - Intronic
1030413449 7:109211639-109211661 GAGTTTTTTTTTTAACATAAAGG + Intergenic
1030447787 7:109669148-109669170 GAGTTATTTTTTTAAGTGTGAGG + Intergenic
1030664977 7:112266553-112266575 GACTTTTTTTTTTGACAGCGGGG + Intronic
1030905846 7:115181408-115181430 GTTTTTTCTTTTTAATTGCCTGG - Intergenic
1031080163 7:117250237-117250259 GAATTTTTTTTTTAAGAGACAGG + Intergenic
1031886144 7:127248055-127248077 CAGATTTTTTTTTAAATGCCTGG - Intronic
1031891218 7:127295220-127295242 GAGTTTTCTTTTTAAGTGACTGG - Intergenic
1031916775 7:127570777-127570799 GGGTTGATTTTTTAACTACCAGG - Intergenic
1032108824 7:129057204-129057226 TTGTTTGTTTTTTAAGTGCCAGG - Intergenic
1033077192 7:138260531-138260553 AAATTTTTTTTTTAAGAGCCAGG - Intergenic
1033154628 7:138946477-138946499 GAATTTTTTTTTAAAAGGCCTGG + Intronic
1033335452 7:140448423-140448445 AATTTTTTTTTTTAATTGGCTGG + Intergenic
1034141866 7:148827432-148827454 GAATTTTGTTTTTGACTGACTGG - Intronic
1034633486 7:152548948-152548970 AAGTTTTTCTGTTGACTGCCTGG - Intergenic
1034993643 7:155564601-155564623 GAGTTTTTATTTTAACTTGCTGG - Intergenic
1035137979 7:156726452-156726474 GTGTTTTTTTTTTAAGTTCTAGG - Intronic
1035139507 7:156744072-156744094 GAATTTTTTTTTTAAGAGACAGG + Intronic
1035488034 7:159244635-159244657 GTGATTTTTTTTTAAATGTCAGG - Intergenic
1035665932 8:1379654-1379676 GAGTTTACTTTCTAACTGGCAGG + Intergenic
1035943214 8:3928308-3928330 GTATTTTTCTTTTAATTGCCAGG + Intronic
1035948718 8:3994614-3994636 GACTTTTTTTTTTAACTAGTCGG - Intronic
1036057098 8:5267743-5267765 GACTTTTTTTTTTCAGTGGCAGG - Intergenic
1037285507 8:17294482-17294504 GAATTTTTTTTCGTACTGCCTGG - Intronic
1037352207 8:17972605-17972627 GAGTTTTATCTTTAGATGCCAGG - Exonic
1037868543 8:22468535-22468557 GAGTTTTTTTTTTAATCAGCTGG + Intronic
1037894582 8:22643334-22643356 AACTTTTTTTTTTAACAGACAGG + Intronic
1038000649 8:23388420-23388442 AATTTTTTTTTTTAATTGGCTGG + Intronic
1038034652 8:23676816-23676838 GAGATTTTTATTTAATTTCCTGG + Intergenic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1038260298 8:25987040-25987062 CAGTTTTTTTTTTTAATTCCAGG - Intronic
1038521021 8:28231983-28232005 GATTTTTTTTTTTTACTCTCAGG + Intergenic
1038599524 8:28925631-28925653 AGATTTTTTTTTTCACTGCCAGG - Intronic
1038922327 8:32098628-32098650 GGGTTCTATTTTAAACTGCCTGG + Intronic
1039876549 8:41591257-41591279 GAGGTTGGTTTTTAACTACCAGG + Intronic
1040692578 8:49957803-49957825 AAATTTTTTTTTTAAAAGCCAGG + Intronic
1041299535 8:56396562-56396584 TTTTTTTTTTTCTAACTGCCTGG - Intergenic
1041363644 8:57078123-57078145 GTCTTTTTTTTTTAACTTCTTGG - Intergenic
1042028055 8:64444792-64444814 CTGTTTTTTTTTTAACTGGTAGG - Intergenic
1042346971 8:67737385-67737407 GACTTTTTCTTTTAAATGGCTGG - Intronic
1042769464 8:72364089-72364111 GAGATTTTTTTGTATCTGCAGGG + Intergenic
1044190182 8:89306770-89306792 CAGTTTTATTTTTAATTGGCAGG - Intergenic
1044244334 8:89924355-89924377 TAGTTTTTTTTTTAAGTGTTAGG + Intronic
1044595152 8:93952512-93952534 TAGTTTTTCTTTTAACAGTCAGG + Intergenic
1044691849 8:94888539-94888561 GAGTTTTTTTTTTTTTTGACAGG + Intronic
1044982529 8:97731127-97731149 CATTTTTTTTTTTAACAGACAGG + Intergenic
1045201422 8:99986018-99986040 AAATTTTTTTTTTACCAGCCTGG + Intronic
1045792857 8:106005884-106005906 GAGTTTTATTATTAAGTGCCTGG - Intergenic
1045883098 8:107064481-107064503 TAGTTTTCCTTTTAACAGCCCGG + Intergenic
1046850469 8:118966678-118966700 GTTTTTTTTTTTTAAATGACTGG + Intergenic
1047121413 8:121908838-121908860 TAGTTTTTCTTTTAACAGTCAGG - Intergenic
1047243656 8:123118658-123118680 CATTTTTTTTTTTTACTGGCTGG - Intronic
1047381587 8:124369630-124369652 GAGTTTTTCATTTATCTGGCTGG + Intronic
1047982257 8:130195520-130195542 GAATTTTTTTTTTAAGAGACAGG - Intronic
1047998734 8:130359210-130359232 CACTTTTTTTTTTAACTTGCAGG + Intronic
1048557274 8:135491900-135491922 TAATTTTCTTTTTCACTGCCTGG + Intronic
1048791706 8:138110333-138110355 GAGCTTTTTTTATAAATGCAAGG + Intergenic
1049894202 9:98569-98591 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1049920424 9:358243-358265 GAATTTTTTTTTTATTAGCCAGG - Intronic
1050143610 9:2542202-2542224 GGGTTGTTTTTTTAAGTTCCAGG + Intergenic
1050203487 9:3173937-3173959 TAGTTCTTCTTCTAACTGCCAGG + Intergenic
1050418869 9:5441468-5441490 GACTTTTTTTTTCAATTTCCTGG - Intergenic
1050420892 9:5464314-5464336 GGGATTTTTTTTTAAATACCTGG + Intronic
1050753673 9:8973003-8973025 GTGTTTTTTTTTTTTCTCCCTGG - Intronic
1050984276 9:12062188-12062210 CAGTTTTTTTTTTAATGGGCTGG - Intergenic
1051051597 9:12939563-12939585 GAGTTTTTCACTTAACTGCAGGG - Intergenic
1051307497 9:15728841-15728863 AATTTTTTTTTTTAACTTACGGG - Intronic
1051670857 9:19508786-19508808 TAATTTTTTTTTTAACAGACAGG - Exonic
1052070792 9:24079387-24079409 GAATATTTTTAGTAACTGCCTGG + Intergenic
1052596938 9:30573441-30573463 GATTTTTTTTTTTAAGTTCTGGG - Intergenic
1052631438 9:31046441-31046463 AAAGATTTTTTTTAACTGCCTGG - Intergenic
1053735429 9:41098658-41098680 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1054692949 9:68332743-68332765 GAGGTTTATTTTTAATTGCTAGG - Intronic
1055012012 9:71577482-71577504 GTTTTTGTTTTTTGACTGCCAGG + Intergenic
1055132212 9:72788841-72788863 TAGTTTTTTTTTTAATTCACTGG + Intronic
1056245501 9:84691106-84691128 GAGTTTCTCTTTTCACTGCCAGG - Intronic
1056424224 9:86460521-86460543 AAGTTTTTCTTTTAACAGCCCGG + Intergenic
1057067125 9:92065512-92065534 TGTTTTTTTTTTTAACTGCTAGG - Intronic
1057657588 9:96968961-96968983 GATTTTTTTTTTTAAGAGACAGG - Intronic
1058056801 9:100457081-100457103 GAGATTTTTTTTTTTCTGGCTGG + Intronic
1058075032 9:100642357-100642379 CAGGTTTTTTTTTAATTTCCTGG - Intergenic
1058217815 9:102257013-102257035 TAGTTTTTTTTTTCTCTTCCTGG + Intergenic
1058228887 9:102400994-102401016 TTTTTTTTTTTTTAATTGCCTGG - Intergenic
1058408967 9:104709270-104709292 GGATTTTTTTTTTAACTATCAGG + Intergenic
1058526039 9:105858566-105858588 GAGTTTCTTTGTTGTCTGCCTGG - Intergenic
1058805593 9:108588129-108588151 GAGGCATTTTTTTAACTACCTGG - Intergenic
1059180658 9:112209562-112209584 GGGATTCTTTTTAAACTGCCAGG + Intergenic
1059217950 9:112584056-112584078 GATTTTTTTTTTTAAGAGACTGG - Intronic
1059463932 9:114453569-114453591 GTGAGTTTTTTTTAACTGTCAGG - Intronic
1059560237 9:115327706-115327728 GAGTTTCTTTCTTTATTGCCTGG - Intronic
1059584741 9:115593860-115593882 GATTTTTTTTTTTAAATTCAGGG + Intergenic
1059729327 9:117041250-117041272 CAATTTTTTTTTTTACTGCTAGG + Intronic
1060185258 9:121560309-121560331 CAGTTTTTCTTTGCACTGCCAGG - Intergenic
1060512883 9:124246969-124246991 CAGTTTATTTTTTAACTGTAGGG + Intergenic
1060688317 9:125632427-125632449 GAGTTTTCCTTCTAACTACCTGG + Intronic
1203733798 Un_GL000216v2:116364-116386 GTGTTTTTGTGTAAACTGCCTGG - Intergenic
1203616002 Un_KI270749v1:65213-65235 GAGTTTTTTTTTTATATGGTAGG - Intergenic
1185831576 X:3308054-3308076 CAGTTTTTTTTTTAACTCTGTGG - Intergenic
1185907106 X:3945365-3945387 GCATTTTTTTTTTAATTGCAAGG + Intergenic
1186432195 X:9514332-9514354 GTGTTTTTTTTTTAATTTGCAGG + Intronic
1186648906 X:11537942-11537964 GGGTTTTTTTTTTTATTCCCAGG - Intronic
1186741230 X:12520511-12520533 TATTTTTTTTTTTAACTGTGGGG - Intronic
1186913935 X:14199613-14199635 TATTTTTTTTTTTAAGTTCCAGG - Intergenic
1186993026 X:15089337-15089359 TAGTTTTTCTTCTAACAGCCAGG - Intergenic
1187342576 X:18434341-18434363 GAGTTATTGATTTACCTGCCTGG - Intronic
1187635645 X:21225120-21225142 AACTTTTTTTTTTAACTCCGTGG - Intergenic
1187703612 X:21988279-21988301 GCAGTTTTTTTTTAACTGCCAGG + Intronic
1187826711 X:23338444-23338466 GAATTGTTTTGTTAACAGCCTGG - Intronic
1187947010 X:24435903-24435925 TTTTTTTTTTTTTAAATGCCGGG - Intergenic
1188716394 X:33464246-33464268 GAGGATTTTGTTTTACTGCCTGG - Intergenic
1188970054 X:36604296-36604318 GATTTTATTTTATAACTGGCAGG - Intergenic
1189453742 X:41164363-41164385 GTGTTTTGTTTTTAACCACCTGG + Intronic
1189652217 X:43203032-43203054 TTGTTTGTTTTTTAACTGTCAGG + Intergenic
1190211863 X:48455257-48455279 AAGTTTTTTTTTTAATTAGCTGG - Intergenic
1190943858 X:55072305-55072327 TAGTTTTTCTTCTAACAGCCAGG + Intergenic
1191079526 X:56494665-56494687 GAGTTTTCCTTCTAACTGTCAGG + Intergenic
1191225166 X:58035021-58035043 GAGTTTTTTTCCTAAGTCCCTGG + Intergenic
1191802802 X:65099636-65099658 TAGTTTTTCTTTCAACAGCCAGG - Intergenic
1191825208 X:65357231-65357253 GAGTCTTTTTGCAAACTGCCTGG - Intergenic
1192020674 X:67387196-67387218 TAGTTTTCTTTTTAACAGTCAGG - Intergenic
1192570155 X:72196682-72196704 GTGTTTTTTTTTTAACTGGTGGG + Intronic
1192701679 X:73481557-73481579 TAGTTTTTTTTCTAACAGTCAGG + Intergenic
1192977555 X:76302646-76302668 GTGTTTTTTTTCTAACAGTCAGG + Intergenic
1193228329 X:79012626-79012648 TAGTTTTTTTTCTAACTTTCAGG + Intergenic
1193330031 X:80225374-80225396 CAGGTTCTTTTTTAACTGACAGG + Intergenic
1193502129 X:82290765-82290787 GATTTTTTTTATTAACTGAGAGG + Intergenic
1193741130 X:85218293-85218315 AAGATTTTTTTTTAACTGAATGG - Intergenic
1193796395 X:85879948-85879970 GAATTTTTTTTTTAAACTCCAGG + Intronic
1193853594 X:86570724-86570746 GACTTTTTTTTTTAAGTTTCTGG - Intronic
1194047071 X:89021240-89021262 AAATTTTTTTTTAAATTGCCAGG + Intergenic
1194155830 X:90387559-90387581 CACTTTTTTTTTTAACTTTCTGG - Intergenic
1194228208 X:91287941-91287963 GAGTTTGACTTTTAACTCCCTGG - Intergenic
1194907002 X:99590167-99590189 GAGTTTTTTTTTCTACCTCCCGG - Intergenic
1195215235 X:102692948-102692970 TATTTCTTTTTTTAGCTGCCTGG - Intergenic
1195425670 X:104726977-104726999 GATTTTTTTTTTTAATTTTCAGG - Intronic
1195432090 X:104800356-104800378 TAGTTTTTTTTTTAAATACCTGG - Intronic
1195820768 X:108943633-108943655 TAGTTTTTCTTTTAACAGTCAGG + Intergenic
1196236144 X:113283064-113283086 AAATTTATTTTTTAAATGCCAGG + Intergenic
1196417431 X:115486779-115486801 GTGTTTTTTTTTTTTCTGACTGG - Intergenic
1196987907 X:121295051-121295073 GACTTTTTTTTTTAAGAGACAGG + Intergenic
1197089059 X:122515002-122515024 GACTTCTTTTTTTAATTGCTGGG - Intergenic
1197133828 X:123037754-123037776 GATTTTTTTTTTTAAGTGGGAGG - Intergenic
1197421651 X:126242651-126242673 GTGTTTTTATTTTTAATGCCCGG - Intergenic
1197676577 X:129337030-129337052 GAGTTTGATTCTTAAGTGCCTGG - Intergenic
1199442873 X:147888518-147888540 GAGTTTGATTATTAAATGCCTGG + Intergenic
1199522580 X:148752733-148752755 GTGTTTTTATTTTAACTTCATGG + Intronic
1199995846 X:153025713-153025735 GAGTTTTTTTTCTGAGTGCGTGG + Intergenic
1200502178 Y:3964513-3964535 CACTTTTTTTTTTAACTTTCTGG - Intergenic
1200737452 Y:6814739-6814761 TAGTTTTTCTTTTAACTATCAGG - Intergenic
1202627212 Y:56872056-56872078 GTGTTTTTGTGTAAACTGCCTGG + Intergenic