ID: 960356147

View in Genome Browser
Species Human (GRCh38)
Location 3:116655895-116655917
Sequence TGGGCTGTTCACTTATTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960356147_960356151 -4 Left 960356147 3:116655895-116655917 CCCTGAAATAAGTGAACAGCCCA 0: 1
1: 0
2: 1
3: 12
4: 158
Right 960356151 3:116655914-116655936 CCCAAATTGGCCTCCCCAAATGG 0: 1
1: 0
2: 6
3: 58
4: 658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960356147 Original CRISPR TGGGCTGTTCACTTATTTCA GGG (reversed) Intronic
911979876 1:104553794-104553816 TGAGCTATTCAGTTATTTCCTGG - Intergenic
913032011 1:114917218-114917240 TTGCATGTTCACTTATTTGAAGG - Intronic
913560773 1:120016964-120016986 TGGGCTGTGGAGTTATTGCAAGG + Intronic
913637354 1:120776639-120776661 TGGGCTGTGGAGTTATTGCAAGG - Intergenic
914214842 1:145616122-145616144 TAGACGGTTAACTTATTTCAGGG - Intronic
914281355 1:146176379-146176401 TGGGCTGTGGAGTTATTGCAAGG + Intronic
914466784 1:147936515-147936537 TAGACGGTTAACTTATTTCAGGG - Intronic
914542400 1:148627314-148627336 TGGGCTGTGGAGTTATTGCAAGG + Intronic
914624233 1:149443931-149443953 TGGGCTGTGGAGTTATTGCAAGG - Intergenic
916204929 1:162307299-162307321 TAGTCTATTCACTCATTTCAAGG - Intronic
916923069 1:169488798-169488820 TGGGTTGTACACTTAATTAATGG - Intergenic
917182839 1:172318168-172318190 AGGGCTGTTGAATTTTTTCAAGG - Intronic
918945732 1:191061945-191061967 TGGTCTTTTCACATATTTCTTGG + Intergenic
923343988 1:233033639-233033661 TGGGCTGTTTTAATATTTCACGG + Intronic
923823653 1:237475316-237475338 TGGGGTGTTCTCTTATTTTGGGG + Intronic
1063126161 10:3138390-3138412 TGGGCTGTGCACTCATGTCCCGG + Intronic
1063338629 10:5242102-5242124 TGATTTATTCACTTATTTCATGG - Intergenic
1064155610 10:12900985-12901007 TGGGCAGTTCTCTTAGGTCAGGG - Intronic
1064906347 10:20350025-20350047 TTGGTTGTTCACTTTTCTCATGG + Intergenic
1064949716 10:20834674-20834696 GGTCCTGTTCACTTATCTCAAGG - Intronic
1072203756 10:93183915-93183937 TAGGATGTTCACTTATAACAGGG + Intergenic
1076711794 10:132339824-132339846 AGGACTGTACACTTATTTTAGGG - Intronic
1083862036 11:65425588-65425610 TGGGCTTTTAACGTATTTAAGGG + Intergenic
1086796712 11:91113859-91113881 TGGGCTGTTCCTTTTTTTCCAGG + Intergenic
1089592725 11:119555077-119555099 AGGGCTTTTAACTTATTTCTGGG - Intergenic
1090059184 11:123449015-123449037 TGGGATGCTCTCTTATTTCCAGG + Intergenic
1091824111 12:3497157-3497179 TTGGCTGTTCACATATTTTCAGG - Intronic
1092847428 12:12596686-12596708 TGGGCCTTCCACTAATTTCAAGG - Intergenic
1093120233 12:15261873-15261895 TGGGCTGTTTTCTTATTTTTTGG - Intronic
1095513122 12:42975440-42975462 TGGGGTTTTCACTTCTTTCAAGG - Intergenic
1096056275 12:48655060-48655082 TGGGCTTTTCTCTTTTTTCTAGG - Exonic
1097045087 12:56181586-56181608 TGGGCTGTTCACCTATAGGATGG + Exonic
1097699918 12:62809346-62809368 CGGCCTGTACACTTATTTTAAGG + Intronic
1099084105 12:78223766-78223788 TGGGATGAACACTTATTTGAAGG + Intergenic
1100567989 12:95817287-95817309 TTGGCTGTTCACTGTGTTCATGG + Intronic
1101752333 12:107592169-107592191 GGGACTGTTCACATATTTCTTGG - Intronic
1105434693 13:20366291-20366313 TGGCCTGCTCAGTTATTTCCAGG + Intergenic
1111070920 13:83167194-83167216 TGTGCTGTTCTCTTCTTTCTGGG - Intergenic
1112402583 13:99088251-99088273 TGGGCCATTCCCTCATTTCACGG - Intergenic
1114508388 14:23235405-23235427 TGAGCTAATCACTTTTTTCATGG + Intronic
1114698814 14:24655773-24655795 TGAACTGATCACTTATCTCAGGG + Intergenic
1114980203 14:28154464-28154486 TGGGCTCTTCACCCATTTCTGGG + Intergenic
1120152433 14:81052105-81052127 TGGTCTGGGCAATTATTTCATGG - Intronic
1120238936 14:81927036-81927058 TAAGCTGTTCACTTTGTTCATGG - Intergenic
1122266107 14:100547629-100547651 TGGGCTGTGCACCCATTGCAAGG - Intronic
1125168233 15:36736618-36736640 TGGGATGCTGAGTTATTTCAGGG + Intronic
1125518457 15:40335699-40335721 GGGGCTATTCTCTTGTTTCAGGG - Exonic
1125707832 15:41756116-41756138 TTGGCTTTTCACTGTTTTCACGG - Intronic
1126425671 15:48524666-48524688 TGGGCTGTGCACTCAGGTCACGG + Intronic
1128487936 15:68114907-68114929 TGGGCAGTTCTCTTCTTTCTTGG + Intronic
1129320266 15:74770863-74770885 TGGGCTGCTCCCTGATTTGAAGG - Intergenic
1133330346 16:4969201-4969223 AGGGCCTTACACTTATTTCAGGG - Intronic
1135332432 16:21571891-21571913 TGGTCTGGTCAATTATTTCTTGG + Intergenic
1137562026 16:49508996-49509018 GGAGCTGTTGCCTTATTTCACGG - Intronic
1140592258 16:76367905-76367927 TAGGCTATTCACTGATTTCCAGG + Intronic
1142398626 16:89847632-89847654 GGGGCTGTGCAGTCATTTCATGG - Intronic
1149208084 17:54272145-54272167 TGTGTTTTTCACTGATTTCAAGG + Intergenic
1151101472 17:71561076-71561098 TGGGCTGGTAATTTGTTTCATGG - Intergenic
1155736838 18:29234915-29234937 TTTGCTGTTCAATGATTTCAAGG + Intergenic
1157457182 18:47842959-47842981 TGGGCTTTTCTCATATTTGAAGG - Intronic
1159483754 18:69026617-69026639 TGGGCTTTTCTCTGACTTCAGGG - Intronic
1163324711 19:16595842-16595864 TGGGCAGTTCACTTCTTTCTAGG + Intronic
1164550884 19:29211750-29211772 TGGGCTCTGCACTTTCTTCATGG - Intronic
1166382939 19:42364441-42364463 TGGACTGATCACTTAGTTCATGG - Intronic
1167563864 19:50243931-50243953 CGATCTGTTCACATATTTCAAGG + Intronic
1168571994 19:57478080-57478102 AGGGTTATTCACTTACTTCAAGG - Intergenic
925145203 2:1578192-1578214 AGGGCTGTTCAGTCAGTTCAGGG - Intergenic
931968129 2:67556123-67556145 TGGGCTATGCTGTTATTTCAGGG + Intergenic
933300446 2:80534738-80534760 TTGGCAATTCACTTATTCCAGGG + Intronic
934666356 2:96174041-96174063 TGGGCTGTGCAATTATGTCTAGG + Intergenic
935424556 2:102906567-102906589 TGGGGCGTTCCCTTATTCCATGG + Intergenic
935849373 2:107201657-107201679 GAGGCTGTCTACTTATTTCAGGG + Intergenic
937695982 2:124809017-124809039 GGGGCTGTTCAGTTCTTCCATGG - Intronic
941038454 2:160592954-160592976 TTGCCTTTTCACTTATTTTATGG + Intergenic
943487060 2:188498402-188498424 TGGGCTTTTTAATTATTTCTTGG - Intronic
944636874 2:201683082-201683104 TGGACTGTTCACACATTTCTGGG - Intronic
945612757 2:212025785-212025807 TTGGCTCATCACTTATTTTAGGG - Intronic
946428223 2:219611268-219611290 TGGGCTGATCAAGTACTTCAGGG - Intronic
1171162382 20:22939678-22939700 TATGCTTTTAACTTATTTCAGGG + Intergenic
1172005700 20:31817910-31817932 TAGCCTGTTCACATAGTTCATGG + Intergenic
1174802895 20:53579974-53579996 TGGCCTTTTCATTTCTTTCAGGG + Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175759569 20:61552171-61552193 TGGCCTTTTCACTTTTTTGATGG - Intronic
1181155931 22:20920682-20920704 TAGGCTGCTCACTTATTCCCTGG + Intronic
1185005618 22:48275083-48275105 TGGGATGTTCCCTTATCTCTAGG + Intergenic
949192064 3:1262005-1262027 TGGGTTTTTCATTTATTTGAAGG - Intronic
949459461 3:4274648-4274670 TGGGATATTCAGTTTTTTCAGGG - Intronic
949616653 3:5760926-5760948 TGGGCTGATCACTGAGGTCAGGG - Intergenic
950935690 3:16836635-16836657 TGGCCTTTTCCCTGATTTCAGGG - Intronic
952060676 3:29505115-29505137 TGGTCTGGTCACTTATTTATTGG - Intronic
953586488 3:44205922-44205944 TGGGCTATTGGCATATTTCATGG - Intergenic
955965354 3:64383390-64383412 TGGGCTGTTTACTAATCTCCTGG + Intronic
957934345 3:86923181-86923203 TGTGCTTTTCAATCATTTCAGGG - Intergenic
957938869 3:86978643-86978665 TGTCCTTTTCACTTATTTCCAGG - Exonic
959307103 3:104681427-104681449 TGGTCTTTTCACTTTTTTGATGG - Intergenic
960356147 3:116655895-116655917 TGGGCTGTTCACTTATTTCAGGG - Intronic
960431322 3:117572037-117572059 TGGACTCTTGATTTATTTCATGG + Intergenic
960893721 3:122479013-122479035 TGAGCTTATCAGTTATTTCATGG - Intronic
960952056 3:123005730-123005752 TGAGCTCTTCACTTTTTTCCAGG + Intronic
962385153 3:134926985-134927007 TGGGCAGTTGGCTAATTTCAGGG + Intronic
963122130 3:141785319-141785341 TTGGCTGTTCAGCAATTTCACGG + Intronic
964210445 3:154220860-154220882 TTGCCTTTTCACTTTTTTCATGG - Intronic
964854806 3:161135395-161135417 TGGGTTCTTTTCTTATTTCAAGG - Intronic
965200934 3:165656630-165656652 TGGTCTTTTCACATATTTCTTGG - Intergenic
965682490 3:171265910-171265932 TTGGCTGTTCAGTTATCCCATGG + Intronic
966058210 3:175722891-175722913 ATGGCTGTTCACTCTTTTCAAGG - Intronic
967784641 3:193478571-193478593 TGGTCTGTTCACATTTTTCCTGG - Intronic
970183183 4:13420688-13420710 TGGGCTGTTGAATTCTGTCAAGG - Intronic
970366709 4:15366452-15366474 TGGGCTGTGCATTTTTTTCCAGG - Intronic
971483216 4:27132692-27132714 TGGTCTGTGTACTTTTTTCAGGG + Intergenic
971525472 4:27612273-27612295 TGAGCAGTTTACTGATTTCAAGG + Intergenic
972247955 4:37265879-37265901 TGGGCTGTGCACATCTTTCAGGG + Intronic
973937977 4:55869958-55869980 TTGGCAGTTTCCTTATTTCAGGG + Intronic
974268414 4:59617061-59617083 TGGGCTGTTCTCTTTCTTTAGGG - Intergenic
977892164 4:102324856-102324878 GGGACGGTTCACTTGTTTCAAGG - Intronic
983850073 4:172569646-172569668 TTTGATGTTCCCTTATTTCAGGG - Intronic
985102739 4:186474598-186474620 TTGGCTGGGCACTTTTTTCAGGG + Intronic
988611311 5:32728607-32728629 TGAGCTGTTTTCTTATTTCAAGG - Intronic
989254580 5:39352314-39352336 TGGGCTGCTGACTTATCTCTGGG - Intronic
992006089 5:72478866-72478888 TGGGCTTTGGACTGATTTCAGGG - Intronic
992910686 5:81393753-81393775 TGGGCTCCTCACTTGTTTAATGG + Intronic
993224173 5:85143799-85143821 TGGTTTGTTCACTTTTTTTATGG - Intergenic
993229559 5:85215342-85215364 TGAACTGTTTACTTAGTTCAAGG + Intergenic
993753981 5:91704203-91704225 TGGGCCATTCTCTTATTTGATGG - Intergenic
993762915 5:91818947-91818969 TGGGCATTTCAATTATTTAAAGG + Intergenic
996027879 5:118669222-118669244 TGGGCTGGGCAATGATTTCATGG - Intergenic
996100214 5:119437608-119437630 TGAGCTTTCCACATATTTCAGGG + Intergenic
998981815 5:147712233-147712255 TGGCCTGTGCAGTTATTTCCTGG - Intronic
1000924301 5:167175270-167175292 TGTGCTGTTAACATATCTCAGGG - Intergenic
1003306974 6:4937972-4937994 TGGGCAGATAACTGATTTCAAGG + Intronic
1007853513 6:44829606-44829628 TGGGCTGTTCAGCTAATTAATGG - Exonic
1012117506 6:95321667-95321689 TTGGCCGTTCATTTATTTCAGGG - Intergenic
1012298573 6:97555485-97555507 TGGGCTGTTCAAAAATTTCATGG + Intergenic
1012372725 6:98527217-98527239 TGGGCTAGTCACTTATTTAGTGG + Intergenic
1012447006 6:99316772-99316794 TTGGGTGATCACTTAGTTCATGG - Intronic
1013788149 6:113806305-113806327 TGGCCTGACCACTTATTCCATGG - Intergenic
1014194426 6:118536671-118536693 TGGCCTTTTCTCTTATCTCATGG - Intronic
1015262090 6:131249814-131249836 TAGGCTGTTGACATATTTGATGG + Intronic
1015817002 6:137221060-137221082 GGGGCTGTCCATTTCTTTCATGG + Intergenic
1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG + Intronic
1023358488 7:39391986-39392008 TGGGCTGTTCATTGACTTCTAGG - Intronic
1024888054 7:54167347-54167369 TGGGGTGTTCTCTTTTTTTATGG - Intergenic
1025597296 7:62946778-62946800 TGGGATGTTCACTTTTTTGCAGG - Intergenic
1028627819 7:92897403-92897425 TGGTCTTTTCACATATTTCTTGG + Intergenic
1031534862 7:122920786-122920808 TGAGCAGTTCACTCATTTTAAGG + Intergenic
1033693880 7:143766928-143766950 TGAGCTTTTCTCTTATCTCATGG - Intergenic
1035126440 7:156611330-156611352 TGGTCTGCTCACTGATTTCTTGG + Intergenic
1037545589 8:19916968-19916990 TGGTCTTTTCACATATTTCTTGG + Intronic
1038219023 8:25590060-25590082 TTGGCTGCTTACTTATTTCCAGG + Intergenic
1042797375 8:72679113-72679135 TTGGCTGTGATCTTATTTCATGG + Intronic
1043239864 8:77919041-77919063 TGGGCTGTCCACATGTGTCATGG - Intergenic
1046389000 8:113543032-113543054 TGGGCTATTCACTGTCTTCAGGG - Intergenic
1046593940 8:116238426-116238448 TCGGCTTATCACTTATTTTAGGG - Intergenic
1047625532 8:126652358-126652380 TAGGCTGGTCTCTAATTTCAGGG + Intergenic
1049763136 8:144339744-144339766 TGGGCTGTCCACTTATTTCCTGG - Intergenic
1050192795 9:3045932-3045954 AGGGCTTTTCACTTATTTGAGGG - Intergenic
1050587530 9:7128435-7128457 AGGGCTGCTCCCTTATTTCTTGG - Intergenic
1051055374 9:12978992-12979014 TGGTATGTTCATTTATTTTAAGG - Intergenic
1051283601 9:15470081-15470103 TAGGCTATTGACTTATTTTAAGG - Intronic
1055541195 9:77307112-77307134 TGGGCTGTTCTCTTAACTCCTGG + Intronic
1058137443 9:101322583-101322605 TGGGCTCTTCACTGTTTACAAGG - Intronic
1188470634 X:30534313-30534335 TGGCCTGTTGACATATTTCTTGG - Intergenic
1188619419 X:32201719-32201741 TGGGCTGTCCACTTACTCCCTGG + Intronic
1189267492 X:39728197-39728219 TGGGCTGTACACTTAGTCCCCGG - Intergenic
1191725619 X:64277737-64277759 TGTGGTGTTCTCTTATTTCCTGG + Intronic
1195643282 X:107201079-107201101 AGGAATGTTCACTTTTTTCATGG + Intronic
1199538212 X:148927699-148927721 TGAGATGTTGACTTCTTTCATGG + Intronic
1201703589 Y:16910916-16910938 TGGGGGATTCACTCATTTCATGG - Intergenic
1202167216 Y:22002714-22002736 TGGGCTGTTTAAGTATTTCAGGG + Intergenic
1202224143 Y:22583655-22583677 TGGGCTGTTTAAGTATTTCAGGG - Intergenic
1202318971 Y:23612005-23612027 TGGGCTGTTTAAGTATTTCAGGG + Intergenic
1202551798 Y:26058052-26058074 TGGGCTGTTTAAGTATTTCAGGG - Intergenic