ID: 960357280

View in Genome Browser
Species Human (GRCh38)
Location 3:116669197-116669219
Sequence CTTTCTCCCTTGAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960357280 Original CRISPR CTTTCTCCCTTGAAGGATGA AGG Intronic
900897988 1:5497237-5497259 TTGTGGCCCTTGAAGGATGAGGG - Intergenic
903007637 1:20309119-20309141 CTTTCATCCTTGCAGGATGAAGG - Intronic
903520703 1:23946034-23946056 CTTTCTCCATTGAATGATTTTGG + Intergenic
905096878 1:35479994-35480016 CTTTCTCCCTCAAAGGGAGATGG - Intronic
905238750 1:36568359-36568381 CTATCTGCCTTGAGGGAGGAGGG - Intergenic
905789120 1:40781115-40781137 CTTGCTCCATTGATGGCTGATGG + Intergenic
906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG + Intergenic
909769933 1:79408962-79408984 ATTTTTCCCTTGAAGAATGAAGG + Intergenic
915279737 1:154814212-154814234 CTTTCTCCTTAGAATGAGGAGGG + Intronic
916088879 1:161291591-161291613 GTTCTTCCCTGGAAGGATGAGGG - Intergenic
918037833 1:180893088-180893110 CTCTCTCCCTTGAAAAAAGAAGG + Intergenic
918466256 1:184824354-184824376 CTTTCTCCAGTGCTGGATGAAGG - Intronic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
920503634 1:206501230-206501252 CTGTCTCCGCTGAAGAATGAAGG - Intergenic
921252793 1:213313237-213313259 CTATCTGCCTTGAAGGCTGAAGG - Intergenic
921634070 1:217471635-217471657 CTTTCTAACTTGATGGAAGAGGG + Intronic
921756790 1:218866450-218866472 TTTTCTCCCTTGAACAATGCGGG + Intergenic
922451086 1:225737899-225737921 CTACCTGCCTTGGAGGATGAGGG + Intergenic
923359494 1:233196115-233196137 CTTTCTCCGTTGAATTATCATGG - Intronic
924684267 1:246271558-246271580 CTTTCTCCATTGAAGGGTCTTGG + Intronic
924793798 1:247277559-247277581 CATTCTCCCTTTAATGTTGAAGG + Intergenic
1063884093 10:10560446-10560468 CTTTCTACCTGGCAGGATGAGGG + Intergenic
1063885688 10:10576158-10576180 CTAGCTCCCTAGAGGGATGAGGG - Intergenic
1067529194 10:47058269-47058291 CTTTCTTCCGTGAGGGATTATGG - Intergenic
1071304837 10:84290044-84290066 CTGTCAGCCCTGAAGGATGAAGG + Intergenic
1072066315 10:91874953-91874975 CTTTATCCCCTGAAGGATGCTGG - Intergenic
1074748543 10:116560401-116560423 TTTTCTCCCTTGCAGGTTGGAGG + Exonic
1075951289 10:126479681-126479703 CTTTCTCCCATTAAGGCTAATGG + Intronic
1076234292 10:128851748-128851770 CTTTCTCCCTTCAGAAATGAGGG - Intergenic
1076411813 10:130257089-130257111 CTTTTGCCCTTGAAGGACAATGG + Intergenic
1078184100 11:9036979-9037001 CTTTCTCTCTGGAAGGAAAATGG - Intronic
1078613023 11:12838347-12838369 TTTTCTCCCTTAAAGGATCAAGG - Intronic
1079023041 11:16924681-16924703 CTATTTCCCTAGAAGGATAAGGG - Intronic
1079373695 11:19873093-19873115 ATTTCTCCATTGCAGGAGGATGG - Intronic
1081397492 11:42603891-42603913 GTTTCTCCCATTAAGGGTGATGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1084784349 11:71433577-71433599 CTTCCTCTTTTGAAAGATGAGGG - Intronic
1086388011 11:86329415-86329437 CTTTGTATCCTGAAGGATGAAGG + Intronic
1087549139 11:99624877-99624899 CATTCTCCCTTTAGGGGTGATGG - Intronic
1091249915 11:134135275-134135297 CTTTCTCCATTAAATGATGTTGG + Intronic
1091787691 12:3252837-3252859 CTTTCTCCCTTGAGGGCCGGTGG + Intronic
1091861890 12:3792849-3792871 CTTGCTACTTTGAAGGATGGGGG - Intronic
1092771985 12:11905044-11905066 TTTTTTTCCTTGAATGATGAAGG - Intergenic
1094081126 12:26536956-26536978 CTTCTTCCCCTGGAGGATGAAGG + Intronic
1094441174 12:30478661-30478683 AATTCTCCCTAGAAGGAAGAGGG + Intergenic
1094865365 12:34524794-34524816 CTTTCTCCCTTGAATGTGTATGG - Intergenic
1097795578 12:63857922-63857944 CCTCCTCCCTTGAAGAATGATGG + Intronic
1099813181 12:87611706-87611728 ATTTCTCACTTAAATGATGAAGG + Intergenic
1100205684 12:92346795-92346817 CTTTCTCCCCTGATGGATGCTGG + Intergenic
1102557908 12:113740915-113740937 CTTTCTCCATTAGGGGATGAGGG + Intergenic
1102841442 12:116128919-116128941 TATTTTCCCTTGAAGAATGAGGG + Intronic
1102970415 12:117161803-117161825 TTTCCTCCCTTCAAGGCTGAAGG - Intronic
1103212329 12:119176096-119176118 CCTTCTCATTTCAAGGATGAGGG - Intergenic
1109691240 13:65892601-65892623 CTTTCTTCTTTGAACAATGAAGG - Intergenic
1110161132 13:72379947-72379969 CCTGAGCCCTTGAAGGATGAGGG - Intergenic
1111587508 13:90301140-90301162 CTTACTCCTTTGAAGGAAGTTGG - Intergenic
1113007821 13:105727216-105727238 CTCTCCCCCTTGATGGAGGAGGG - Intergenic
1113375014 13:109757070-109757092 CTTCCTCCCTTCCAGGATGAAGG + Intronic
1114219623 14:20684668-20684690 CTTCCTCCCTAGTACGATGATGG - Exonic
1115571465 14:34670667-34670689 CTTTAGGCCTGGAAGGATGATGG - Intergenic
1116373135 14:44161633-44161655 CTTTTTCACTAGTAGGATGAAGG + Intergenic
1116397673 14:44465848-44465870 CTTTCTCACTTGAAGTATTCTGG + Intergenic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1118207850 14:63739736-63739758 CTCTCTGCCTTGTAGGATTATGG + Intergenic
1119964483 14:78898950-78898972 CTCTCTCCCAAGAAGCATGATGG - Intronic
1122033934 14:98933966-98933988 AACTCTCACTTGAAGGATGAGGG + Intergenic
1123146237 14:106133253-106133275 CTTCCTCCCCTGCAGGGTGAGGG - Intergenic
1124991117 15:34674720-34674742 CTTTCTGCCTTGAGGGATGTGGG + Intergenic
1126248074 15:46533907-46533929 CTTTCTCCCTTCAAGAAATAAGG - Intergenic
1126439081 15:48668064-48668086 CTTTCTTCCAGGAAGGCTGAGGG + Intergenic
1130033112 15:80333603-80333625 CTTTCTCCACTGCTGGATGAGGG + Intergenic
1130770210 15:86916671-86916693 GTTTCTCCATTGGAGGGTGAAGG + Intronic
1130978276 15:88793919-88793941 GTTTAACCTTTGAAGGATGAAGG - Intergenic
1133527772 16:6623083-6623105 CTGTGTCCCTTGAAGTATTATGG + Intronic
1141453034 16:84118273-84118295 ATATCTACCTTAAAGGATGAGGG + Intergenic
1141918063 16:87113928-87113950 GTTTCTCTTTTAAAGGATGAAGG + Intronic
1142013552 16:87730506-87730528 CTTTCTCTCCTGAAGCATTAAGG - Intronic
1143164517 17:4891338-4891360 CTTCCTCCATTGAAGGACAAGGG - Intronic
1146560042 17:33860236-33860258 CTTTCTACCTGGAGGGAAGAAGG - Intronic
1150495341 17:65603761-65603783 CTTTCTCCCATGGTGGAAGACGG + Intronic
1151423068 17:74011335-74011357 CTTCCACCCCAGAAGGATGAGGG + Intergenic
1152118274 17:78402109-78402131 CTTTCTCCCCTGGAGGGTGTTGG + Intronic
1154110487 18:11564071-11564093 CTTACTCCCGCGAAGGCTGAAGG - Intergenic
1156687607 18:39668914-39668936 CCTTCCCCCTTGTAGGAAGAAGG - Intergenic
1160243681 18:77140568-77140590 CTGTGCCCCTTGAAGGAGGAAGG - Intergenic
1162669248 19:12240680-12240702 CTTTCTCCATTGAATGATCATGG - Intronic
1163221314 19:15923293-15923315 CTCTCGCCCTGGAAGGAAGAAGG + Intronic
1164925890 19:32129650-32129672 TTTTCTCACTTGCAGAATGAGGG - Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
928264671 2:29801533-29801555 CTTTCAGCCTTCAAGGATCAGGG + Intronic
928424118 2:31164046-31164068 CTTTCTCCCCTGTATTATGAAGG + Intergenic
929023571 2:37577575-37577597 CTATCTCTCTAGAAGGAGGAAGG + Intergenic
929183214 2:39066083-39066105 CCTTCTACCCTGAAGGCTGAGGG - Intronic
929384744 2:41392863-41392885 CTTTCCCCCTTGAATGATCTTGG + Intergenic
930032685 2:47068171-47068193 TTTTCTGACTTGAAGGAGGAAGG + Intronic
930735401 2:54773497-54773519 CTTCCTTTCTTGAATGATGAGGG - Intronic
932634146 2:73373165-73373187 ATTTCTCCCATGGAGGTTGATGG - Intergenic
933274781 2:80271951-80271973 CTTTCTGCCTTGTAGGTGGAAGG + Intronic
933474383 2:82770776-82770798 CTTTCTCTCTTGGAGGAGGAGGG - Intergenic
939561306 2:143735453-143735475 CTTTCTCCCTGGTAGCAAGATGG + Intronic
939623377 2:144447660-144447682 ATTTCCCCTTTGAAGCATGATGG + Intronic
940261894 2:151789751-151789773 CTTGCTGCCTGGAAGAATGACGG - Intronic
940537988 2:154971018-154971040 CTTTGTGCCATGAAGGCTGATGG + Intergenic
944132581 2:196362773-196362795 CTTTCTCCATTAAAGAATGGTGG - Intronic
944178148 2:196856769-196856791 CTTTTTTACTTGAAGGATAATGG + Intronic
945530019 2:210941540-210941562 ATTTCTCCATTGAAGTATCATGG - Intergenic
946933500 2:224695515-224695537 CTAACTCCCTTGCAGGATGTGGG + Intergenic
948652150 2:239454737-239454759 GTTTCTGTCTTAAAGGATGAGGG + Intergenic
1169345578 20:4825553-4825575 TATTCTGCCTTGAAGGATGAAGG - Intergenic
1171996945 20:31738891-31738913 CATTATCCCTTGAAGGTTCAGGG - Intergenic
1173062303 20:39674319-39674341 TTTTCTCCCTTCAAGGCTGAAGG - Intergenic
1173611015 20:44368029-44368051 CTTCCTCCCTAGATGGAAGATGG + Intronic
1174419657 20:50391259-50391281 CTCTCTCCCTGGTAGGCTGAAGG + Intergenic
1175700530 20:61133534-61133556 ATTTCTCCATTGATGGATGGCGG + Intergenic
1177599847 21:23296473-23296495 CTTTCTCCCTTGAAGGACAGTGG + Intergenic
1178725525 21:35048168-35048190 CTTTCTCTCTTGAAAGATGCTGG + Intronic
1179651004 21:42808641-42808663 CTCTCTGCCTTCAAGGATGCGGG + Intergenic
1180019988 21:45117150-45117172 ATTGCTCCCTCGAAGGATGAAGG + Intronic
1181973800 22:26713878-26713900 ATTGCTCCCTTGAGGGATGGGGG + Intergenic
1182192849 22:28481743-28481765 CTTTCTTCCTAGAGGAATGAAGG - Intronic
1184694270 22:46131073-46131095 CTCTCTCCAGTGATGGATGAGGG + Intergenic
950236496 3:11326075-11326097 CTTTCTCTCCTGCAAGATGAAGG - Intronic
951936782 3:28031184-28031206 CTTCCTCACTTTAAAGATGATGG - Intergenic
953054597 3:39377933-39377955 CTTTCTCACGTGTAAGATGAGGG - Intergenic
953493536 3:43368421-43368443 CTATCCCCCTGGCAGGATGAAGG - Intronic
953827208 3:46263984-46264006 CTTTCTCCTTTCTAGGAGGAAGG - Intronic
955193660 3:56785094-56785116 CTTTGTCCCTGGAAGGATCAAGG - Intronic
955306754 3:57840500-57840522 TTTTCTGGCTTGAAGGTTGACGG - Intronic
955313360 3:57913090-57913112 CTTTATCCTTTGAAGTATTATGG + Intronic
956252392 3:67248398-67248420 CTTTCTCTCAAGAAGGCTGAAGG - Intergenic
956792544 3:72691281-72691303 CTTTCTCACTTGAATAATAATGG + Intergenic
956969965 3:74511410-74511432 CTTTATGCCTTGAAGGATAAAGG - Intronic
957179824 3:76862142-76862164 CTTTCTACCTTGAAGAGAGAGGG - Intronic
960357280 3:116669197-116669219 CTTTCTCCCTTGAAGGATGAAGG + Intronic
962265107 3:133939213-133939235 TTTCCTCTCTTGAAGGAAGATGG - Intronic
962897913 3:139732527-139732549 CTTTTTCCCATGAAAGATGAAGG + Intergenic
963876040 3:150475655-150475677 CTTTCTCTATTGAACGATGTTGG + Intergenic
964379661 3:156085621-156085643 CTATCTCCCTTGAAGGTGGAAGG - Intronic
967604483 3:191428864-191428886 CTTTCTCCCAAGACTGATGATGG - Intergenic
968256779 3:197281362-197281384 CTTAATCCCATGAAGGATGGAGG + Intronic
968274474 3:197429483-197429505 ATTTCTCTTTTGAAGGCTGAAGG - Intergenic
969650182 4:8461781-8461803 CTTTCTGCCTTGGAGGAGCATGG + Intronic
970265909 4:14286011-14286033 CTTTCCCCCTTCTAGGATGATGG + Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970477604 4:16439479-16439501 CTCTCTTCCTTCAAGGCTGAAGG + Intergenic
971124859 4:23742432-23742454 CAGACTCCCCTGAAGGATGAAGG + Intergenic
971131678 4:23818008-23818030 CTTTCCCCCCTGAAGTAAGAGGG + Intronic
973951729 4:56022353-56022375 TTTTTTCCCTTGGAGGATGGTGG - Intronic
975237430 4:72015715-72015737 CTTTCTACTTTAAAGGATGAGGG - Intergenic
976483207 4:85569032-85569054 GTTTCTTCCTTGAAGGCTCAGGG - Intronic
976734168 4:88294124-88294146 CTTCCTCCCTGGAAGGAAGATGG - Intergenic
977238733 4:94541149-94541171 CTTTCTCTCTTTAGGGATGTAGG + Intronic
978710712 4:111777188-111777210 CGTTCTCCCTTGATTGATGGGGG + Intergenic
980244064 4:130214961-130214983 TTCTCTCCCTTGCAGAATGATGG - Intergenic
982486744 4:155975544-155975566 ATTTCTCCCTTCAAGGGTGAAGG + Intergenic
982765789 4:159346949-159346971 CTTTCTTCCGTGAAGGATAAAGG - Exonic
983724655 4:170905656-170905678 CTTTCTCCCGTGCTGGATGCTGG + Intergenic
985485121 5:144511-144533 CTTGCTCCCTTGATGGAGCACGG + Intronic
986073407 5:4310226-4310248 CTTTAAACCTTGAATGATGAAGG - Intergenic
986469923 5:8063415-8063437 CTTTCTCACTTAAAGAAGGAGGG + Intergenic
986797279 5:11224264-11224286 CCTTCACACATGAAGGATGATGG - Intronic
987062658 5:14257310-14257332 GTGTCTCCCTTAAAGGATGGAGG - Intronic
987691599 5:21274090-21274112 CTTTTTCCCCTCCAGGATGAAGG - Intergenic
988008607 5:25452832-25452854 TTTTCTCCCTTGGAGGATGGTGG - Intergenic
988708414 5:33748590-33748612 CTTTCTCTCTTGAAGCACTAGGG + Intronic
991599902 5:68341872-68341894 CTGTGTCCTTTGAAGGATGAGGG + Intergenic
991748780 5:69776047-69776069 CTTTTTCCCCTCCAGGATGAAGG + Intergenic
991800358 5:70355859-70355881 CTTTTTCCCCTCCAGGATGAAGG + Intergenic
991828242 5:70654182-70654204 CTTTTTCCCCTCCAGGATGAAGG - Intergenic
991892716 5:71355299-71355321 CTTTTTCCCCTCCAGGATGAAGG + Intergenic
991971425 5:72145440-72145462 TTTTCTCTCTTGATGGATGGTGG + Intronic
992188694 5:74268740-74268762 TTTTCTCCCCTGATGGATGACGG + Intergenic
992657738 5:78927403-78927425 TTTTCTCCCCTGAATAATGAAGG + Intronic
994493514 5:100479258-100479280 CTTTCTCCCTTGACAGTAGAGGG + Intergenic
995369449 5:111402593-111402615 CGATCTCCCTTGTAGGAAGATGG + Intronic
995451752 5:112309829-112309851 CCCTCTCACTTGAAAGATGAAGG + Intronic
1001692578 5:173643985-173644007 CTTTCTACCTTGTGGGATAAAGG + Intergenic
1003141028 6:3471411-3471433 CGTGCTCCTTTGAAGGAAGAAGG - Intergenic
1004012370 6:11702108-11702130 CTTCCTCCTGTGAAGGATGAAGG - Intergenic
1006514143 6:34536703-34536725 CTCACTCCCTTGTAGGAGGAGGG - Intergenic
1007293465 6:40803907-40803929 TTTTCTACCTTTAAGAATGAAGG + Intergenic
1007404895 6:41629493-41629515 CTGTCTCCCTTGAGGGACAAGGG + Intergenic
1008946363 6:57101374-57101396 CTGTGTCCCATGAAGGAAGAAGG - Intronic
1010800559 6:80169360-80169382 CTTTCTCACTTAACTGATGATGG + Intronic
1013639428 6:112058816-112058838 CTTTCACGTGTGAAGGATGAGGG + Intronic
1014342243 6:120224776-120224798 TTTTGTCACTTAAAGGATGATGG + Intergenic
1017017969 6:150116727-150116749 CTTCTTCCCTTGAAAGATGCTGG + Intergenic
1017784625 6:157745047-157745069 CTTTCTAACTTTAAGGAGGATGG + Intronic
1017966386 6:159270662-159270684 ATTTCTCCCTTGAAGTAGGAGGG - Intronic
1018129509 6:160715764-160715786 ATTTCTCCTTTGAAGGAAAATGG - Intronic
1018461978 6:164007223-164007245 CCTTCTCCCATGATGGTTGAGGG + Intergenic
1019398945 7:840090-840112 CTTTCTCTCGAGAAGGAAGACGG + Intronic
1020121646 7:5507418-5507440 CTTTCTCTTTTGGAGGATGGAGG - Intronic
1020231394 7:6321830-6321852 CGCTCTCCCTTGCAGGATGGAGG + Intergenic
1021228454 7:18056612-18056634 CTTTTTCCCGTGCATGATGAAGG - Intergenic
1021346917 7:19540146-19540168 CTTTCACCTTTGAAGGATCCCGG - Intergenic
1022256593 7:28664464-28664486 CTTTCTCTCTCCAAGTATGAAGG + Intronic
1025251289 7:57353231-57353253 CTCTCTCCCTGGTAGGCTGACGG - Intergenic
1029862043 7:103583100-103583122 CTTTCTCCCTAGAAAAATGGAGG - Intronic
1029974043 7:104815897-104815919 CTTTCCCCTTTGAAGAATGAGGG + Intronic
1030887884 7:114961226-114961248 CTTTCTCTCTTGATCAATGATGG + Intronic
1031032760 7:116752554-116752576 CTTTTTCCCTAGAAGGGTAAAGG + Intronic
1031540105 7:122985163-122985185 CTTCCTCTCTTGAAGGAGGTTGG - Intergenic
1032239123 7:130147775-130147797 ATTGCTCCCTGGGAGGATGACGG + Intergenic
1033715007 7:143991804-143991826 TTTTCTTCCCTGAAGGAGGATGG + Intergenic
1034313961 7:150112641-150112663 TTTTTTCCCTTGATGGAGGAGGG - Intergenic
1034792935 7:153988151-153988173 TTTTTTCCCTTGACGGAGGAGGG + Intronic
1034879646 7:154753426-154753448 CTGTCTCCTGTGGAGGATGATGG - Intronic
1035545153 8:475204-475226 CTTTCTCCCTTGAATGGTCTTGG + Intergenic
1035616744 8:1007566-1007588 CATGCTCCCTTTAAGGCTGAAGG + Intergenic
1036008066 8:4689935-4689957 CTTTCTCCCCTGCAGGAAGTGGG + Intronic
1036289865 8:7477801-7477823 CTGTCTCACTTGAGGGATGGGGG + Intergenic
1036331614 8:7833726-7833748 CTGTCTCACTTGAGGGATGGGGG - Intergenic
1036534049 8:9627976-9627998 GTTTCTCCATTGAATGAAGAAGG - Intronic
1040453276 8:47570295-47570317 CTTTCCCCCTTGAATGATCTTGG - Intronic
1043795840 8:84537740-84537762 CTAACTTCCTTGAAGGATGCTGG - Intronic
1044524147 8:93232542-93232564 CTTTCTCCCTTGGTGGTTTACGG - Intergenic
1046051843 8:109032891-109032913 CATTCTCACTTGAAGAAAGAGGG - Intergenic
1047770337 8:128025464-128025486 CTCTCTCCCCTGAGGGCTGAAGG - Intergenic
1048521561 8:135160161-135160183 ATTTGTCCCTTGGAGGTTGAAGG - Intergenic
1051537226 9:18173480-18173502 ATTTTTCCCTTAAAGGATAATGG - Intergenic
1053441417 9:38119362-38119384 CTTTCTCCCTCCCAAGATGAGGG + Intergenic
1055571334 9:77620123-77620145 CTATCTGCCTTGAATGATCAAGG + Intronic
1055866854 9:80824702-80824724 CTTTCTTCATTGAAGGATCTTGG - Intergenic
1057261039 9:93584502-93584524 CTTTCTCCGTTGAATGATCTTGG + Intronic
1057530870 9:95844797-95844819 CTTTCTCCATTGAATGATTTTGG + Intergenic
1059541849 9:115138159-115138181 CTTTCTCCCTTAAAGAAAGCAGG - Intergenic
1062114068 9:134798148-134798170 GTTTCTCCCTTGGTAGATGAGGG + Intronic
1185769482 X:2754698-2754720 CTTTCTCCCATGGTGGATGCTGG - Intronic
1186664034 X:11700351-11700373 CTTTCTCCCTTCTACAATGAAGG + Intergenic
1186944759 X:14553496-14553518 CTTTCTGCCTTGATAGATGATGG + Intronic
1188134072 X:26472435-26472457 CTTTCACCATTGGAGGATGCAGG + Intergenic
1188989226 X:36797132-36797154 CTTTCCCCATTGAATGATGTTGG - Intergenic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1189487264 X:41443168-41443190 TTTCCTCACTTGAAGAATGAGGG + Intergenic
1189752428 X:44235952-44235974 ATTTTTCCCTTGAAGGAAGTTGG - Intronic
1190816622 X:53935360-53935382 CTTTGTCCCTTGACTGAGGAAGG + Intergenic
1191667281 X:63716364-63716386 TTTTCTCCCCTGAAAGATGGAGG - Intronic
1193116944 X:77785189-77785211 ATTTATTCCATGAAGGATGAAGG - Intronic
1196739673 X:119013645-119013667 CTTTCTGCCTTAGGGGATGATGG - Intronic
1197495778 X:127177683-127177705 TTTTCTCCCTTGATGGTAGAAGG - Intergenic
1197657593 X:129133924-129133946 CTTTCTCCCTTGGGGAAAGAAGG - Intergenic
1199706170 X:150427428-150427450 ATTTCACCCTTGAAAAATGATGG + Intronic
1199751267 X:150821393-150821415 CTTTCTCCATTGAATGGTGTTGG - Intronic
1201301025 Y:12504931-12504953 CTTTCTCCCATGGTGGATGCTGG + Intergenic
1201998615 Y:20124404-20124426 CTTGCTCACTTCAAGAATGACGG + Intergenic
1201999369 Y:20134779-20134801 CTTGCTCACTTCAAGAATGAAGG + Intergenic
1202001455 Y:20162623-20162645 CTTGCTCACTTCAAGAATGACGG + Intergenic
1202008044 Y:20300049-20300071 CTTGCTCACTTCAAGAATGACGG + Intergenic
1203336481 Y_KI270740v1_random:6880-6902 CTTGCTCACTTCAAGAATGAAGG + Intergenic
1203336704 Y_KI270740v1_random:9881-9903 CTTGCTCACTTCAAGAATGAAGG + Intergenic
1203337244 Y_KI270740v1_random:17147-17169 CTTGCTCACTTCAAGAATGAAGG + Intergenic