ID: 960357751

View in Genome Browser
Species Human (GRCh38)
Location 3:116674360-116674382
Sequence GTGTACATGCAGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960357751_960357757 14 Left 960357751 3:116674360-116674382 CCCACCTCCTTCTGCATGTACAC 0: 1
1: 0
2: 2
3: 22
4: 239
Right 960357757 3:116674397-116674419 ATTAAGGAACATAAGGTTAGAGG 0: 1
1: 0
2: 0
3: 18
4: 180
960357751_960357755 -2 Left 960357751 3:116674360-116674382 CCCACCTCCTTCTGCATGTACAC 0: 1
1: 0
2: 2
3: 22
4: 239
Right 960357755 3:116674381-116674403 ACAAACTATCAGAATGATTAAGG 0: 1
1: 0
2: 0
3: 11
4: 264
960357751_960357756 7 Left 960357751 3:116674360-116674382 CCCACCTCCTTCTGCATGTACAC 0: 1
1: 0
2: 2
3: 22
4: 239
Right 960357756 3:116674390-116674412 CAGAATGATTAAGGAACATAAGG 0: 1
1: 0
2: 1
3: 24
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960357751 Original CRISPR GTGTACATGCAGAAGGAGGT GGG (reversed) Intronic
900733130 1:4276078-4276100 GTGAAATTGCAGAAGGAGGTGGG + Intergenic
901079641 1:6576701-6576723 GTGTACAGGGAGCAGGAGGGGGG + Intronic
902930603 1:19728677-19728699 GCCTTCATGCAGACGGAGGTAGG - Intronic
906734911 1:48116040-48116062 GGGTACTTGCACAGGGAGGTGGG + Intergenic
907537033 1:55172073-55172095 GTGTTCATGTAGATGGAGTTTGG - Intronic
907539959 1:55206303-55206325 GTGTACATGCAAAATGCAGTGGG + Intronic
907776699 1:57522756-57522778 GTGTCCATCCAGAATGAGGGTGG - Intronic
910662365 1:89687570-89687592 GAGTAAATGGAGAAGGAAGTGGG + Intronic
912778492 1:112522573-112522595 CTGCACAGGCAGCAGGAGGTTGG + Exonic
912871214 1:113308595-113308617 GTGTACATTGACAAGGATGTAGG + Intergenic
913314622 1:117539511-117539533 GTGTACATGCAAATGGAGAAGGG + Intergenic
916115506 1:161481945-161481967 CTGTCCATCCAGAAGGAGGTTGG - Intergenic
918394694 1:184101610-184101632 GTGAGCATGAGGAAGGAGGTAGG + Intergenic
1063518159 10:6716748-6716770 GTAAAGATGCTGAAGGAGGTAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066704278 10:38160734-38160756 ATGAGCATGCAGAAAGAGGTGGG - Intergenic
1066986344 10:42471124-42471146 ATGAGCATGCAGAAAGAGGTGGG + Intergenic
1067414506 10:46093242-46093264 GTGTGCATTCAGTGGGAGGTGGG - Intergenic
1067462702 10:46469345-46469367 GTTTACATGCAGAATGAGTCTGG - Intergenic
1067624493 10:47915292-47915314 GTTTACATGCAGAATGAGTCTGG + Intergenic
1068736483 10:60419082-60419104 GTTTATATTCAGTAGGAGGTTGG - Intronic
1069714862 10:70514151-70514173 GTGGGCATGCAGCAGGAAGTGGG - Intronic
1070667747 10:78357335-78357357 GTGAAAATGCCGGAGGAGGTGGG + Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1072014577 10:91334320-91334342 GTGAACATAAAGAATGAGGTGGG + Intergenic
1072408507 10:95177546-95177568 GTGTACTTGCAAAAGGTTGTGGG - Intergenic
1073703793 10:105959603-105959625 GTGTGCATGCAGGGGGAGGGAGG - Intergenic
1073774492 10:106770788-106770810 GTGTTCATTTAGAAGGAGGGAGG - Intronic
1074510825 10:114110427-114110449 GTGGACATGCAGTAGGAGCCTGG + Intergenic
1076095756 10:127734115-127734137 GTGTAGGTGCAGCTGGAGGTGGG + Intergenic
1076272046 10:129162216-129162238 CTGTTCATTCAGCAGGAGGTGGG + Intergenic
1076637687 10:131893005-131893027 GTGTACATGCAGAAATACGCGGG - Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1080694983 11:34595649-34595671 GTGTACACACAGAAGAAGGAAGG - Intergenic
1080864386 11:36180453-36180475 CTGTACATGTAGAAGTAAGTAGG + Intronic
1081010943 11:37811960-37811982 GTGTCCAGGAAGAATGAGGTAGG + Intergenic
1081762317 11:45584967-45584989 GAGGACAGGCAGAAGAAGGTAGG - Intergenic
1083190860 11:61051375-61051397 GTGTCTGTGCAGAAGGGGGTGGG - Intergenic
1084241865 11:67826706-67826728 GTGTTTATGCAAAAAGAGGTTGG - Intergenic
1084699484 11:70777098-70777120 GTGTAAATGCATATGTAGGTGGG - Intronic
1085390675 11:76180555-76180577 GTGTATGTGCAGGAGGTGGTGGG + Intergenic
1085518304 11:77123901-77123923 GGGGACATGCAGATGGTGGTGGG - Exonic
1086145317 11:83545056-83545078 GTTTACATCCAGAAGGAGCCTGG - Intronic
1086252779 11:84837229-84837251 GTGTACCTGTTGAAGTAGGTAGG + Intronic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1091306333 11:134538643-134538665 CTGTGCATGGAGAAGCAGGTTGG + Intergenic
1091446761 12:548191-548213 GGGTAGATGCAGAAGGTGGGAGG - Intronic
1091791743 12:3275886-3275908 GTGTGCATGAAGAAAAAGGTAGG - Intronic
1091822847 12:3489660-3489682 GTCAACATGCAGAAAGTGGTAGG - Intronic
1093804204 12:23411870-23411892 GTGCTCCTGCAGAGGGAGGTAGG + Intergenic
1093816371 12:23553516-23553538 GTGTACATGTGGAAGAAGGGAGG + Intronic
1094005965 12:25751626-25751648 GTGGACATGAAGAAGTATGTAGG - Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1097904376 12:64905032-64905054 GTGTGCATGCAGGAAGAGGAGGG - Intergenic
1102328996 12:112013437-112013459 GGGTTCCTGCAGAGGGAGGTAGG - Exonic
1102361993 12:112296138-112296160 GTGTAGGTGCAGCAGGTGGTAGG + Intronic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1105438515 13:20397117-20397139 GTGGACATGCAGAAAGATCTTGG + Intergenic
1106559171 13:30833826-30833848 GGAGACATCCAGAAGGAGGTGGG + Intergenic
1107336321 13:39359622-39359644 GAATACAAGGAGAAGGAGGTAGG + Intronic
1107423084 13:40267936-40267958 GTGAACATGGAGGAGGAAGTGGG + Intergenic
1107888562 13:44894478-44894500 GTGGCCAGGCAGCAGGAGGTGGG - Intergenic
1111075335 13:83228246-83228268 GTGCACATGCACATGAAGGTTGG + Intergenic
1111652384 13:91108301-91108323 GTGTGGATGCAGAAGAAAGTTGG - Intergenic
1112000113 13:95202332-95202354 ATGTACATGCAGAGAGAGATTGG - Intronic
1112467760 13:99658624-99658646 GTGGACAGGAACAAGGAGGTGGG + Intronic
1112635258 13:101210181-101210203 ATGTGCATGCAGATGGGGGTGGG - Intronic
1114214295 14:20644392-20644414 AAGTACATTCAGGAGGAGGTAGG - Intergenic
1118667757 14:68088805-68088827 GCGTAACTGAAGAAGGAGGTTGG + Intronic
1119227665 14:72956453-72956475 GTGCACATGCAGGGGCAGGTAGG - Exonic
1123816201 15:23981778-23981800 GTGTACCTGCCGAAGGGGGTGGG + Intergenic
1124016118 15:25877299-25877321 GTTTACAAGCGGAAGGAGGTAGG - Intergenic
1124140389 15:27072313-27072335 GTGTCCATGGAGAAGGAGGTAGG - Intronic
1124969122 15:34467675-34467697 GTGTAGATGGAGACAGAGGTTGG + Intergenic
1125409820 15:39394253-39394275 GTGTACATCCAGACAGAGGCAGG + Intergenic
1125539016 15:40459144-40459166 GTGCCCATGCAGAAGTAGATGGG + Exonic
1125716636 15:41823272-41823294 ATGTACATGCTGGAGGAGGGAGG + Intronic
1126824584 15:52536497-52536519 GAGAATATGCAGGAGGAGGTGGG - Intergenic
1128541148 15:68534213-68534235 ATGTGTATGCACAAGGAGGTGGG - Intergenic
1128550413 15:68594745-68594767 GTGTGCTTGCAGAAGGAAGTGGG + Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128744322 15:70103021-70103043 GTGTCTATGCAGAATAAGGTTGG - Intergenic
1129685987 15:77686381-77686403 GTGAACTTGCAGTAGGAGCTGGG - Intronic
1130102822 15:80906704-80906726 GTGGACATGCGGGCGGAGGTTGG + Exonic
1131596768 15:93805949-93805971 GTGGTCCTGCAGAAAGAGGTTGG + Intergenic
1132267488 15:100487560-100487582 GTGAACATTCAGAAGTGGGTTGG + Intronic
1133353367 16:5117614-5117636 GTGTTTATGCAAAAAGAGGTTGG - Intergenic
1133443285 16:5838291-5838313 GTGTACATGTGGAAAGAGGCAGG - Intergenic
1135522403 16:23187540-23187562 GTGCAGATGCAGATGGGGGTTGG - Intronic
1137720477 16:50624843-50624865 GTGTACATGAGGTGGGAGGTCGG + Intronic
1137857431 16:51808876-51808898 GTGCACATGAAGAGGGAGGGAGG + Intergenic
1140290429 16:73649451-73649473 GTGTATATGCATAAAGAGTTTGG + Intergenic
1140651572 16:77094134-77094156 GTGTACATGAAGAGGAAGGAAGG - Intergenic
1141127920 16:81414388-81414410 GAGACCAGGCAGAAGGAGGTTGG - Intergenic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1142337874 16:89502016-89502038 GTGGACATGGAGCAGGAGGAGGG - Intronic
1143264126 17:5622953-5622975 GTGTAGATGCATCAGTAGGTGGG - Intergenic
1144520328 17:15948470-15948492 GTGTACAGGCAGGAGGGTGTGGG + Intronic
1144560176 17:16314912-16314934 GTGTGCATCCAGAATGAGGTGGG - Intronic
1148513741 17:48196554-48196576 GGGTAAATGCACGAGGAGGTAGG - Intronic
1150074142 17:62178478-62178500 GTCTGCATGCAGATGGAGTTTGG - Intergenic
1151141210 17:71993654-71993676 GTGCACTTGCAGATGGTGGTGGG - Intergenic
1153555912 18:6313030-6313052 GTTTACTTGGAGCAGGAGGTAGG - Intronic
1153747762 18:8198016-8198038 GTGTCCACACAGAAGAAGGTGGG - Intronic
1153969173 18:10209583-10209605 CTGTACATACAGAAAGAAGTGGG + Intergenic
1156439754 18:37172666-37172688 GTGAAAATGCCCAAGGAGGTGGG - Intronic
1158426042 18:57340422-57340444 GTGAAAAGGCAGAAGGAGCTGGG - Intergenic
1158983527 18:62789546-62789568 GTGTAGGTGCAGTAGGGGGTGGG + Intronic
1160855332 19:1214740-1214762 CTGCACAGGCAGCAGGAGGTGGG + Intronic
1161553820 19:4929210-4929232 GTGTCCCTGCAGATGGAGGACGG + Exonic
1165653738 19:37514738-37514760 ATGTACATTCATAAGAAGGTTGG - Intronic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167235125 19:48309590-48309612 GTGTCCAGGAAGAAGGAGGTAGG - Intronic
1167624517 19:50578665-50578687 GTATACCTGCAGGAGGAGCTCGG - Intergenic
1168432980 19:56295930-56295952 ATGTCCATCCAGAAGGAGATGGG - Intronic
925279774 2:2675460-2675482 GTCTACTTGCAGAAAGATGTTGG + Intergenic
926727588 2:16010487-16010509 GTGTACATCCTGAAGGAAGGAGG - Intergenic
928266581 2:29817174-29817196 GTTTACATACAAGAGGAGGTGGG + Intronic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
929469784 2:42179930-42179952 GTGTACATATAGAGGGAGGGAGG + Intronic
930822056 2:55656573-55656595 GTGTACATGGATTAGGATGTGGG + Intronic
931703904 2:64931158-64931180 GGGTTCAGGCACAAGGAGGTTGG + Intergenic
931930340 2:67126191-67126213 GTGTAAATACAGTAGGAGATTGG + Intergenic
933283076 2:80354269-80354291 GTGTACATGTAGGAGGGAGTTGG + Intronic
934898987 2:98142108-98142130 GTGTTTATGCATCAGGAGGTGGG + Intronic
935420598 2:102865217-102865239 GTGCACATGGAGAAGGTGGTTGG + Intergenic
935979802 2:108615562-108615584 GTGTTCATGGAGAAGGATCTGGG + Intronic
939887516 2:147697270-147697292 ATCTAACTGCAGAAGGAGGTTGG - Intergenic
940810461 2:158237134-158237156 GTGTTCATGGAGTAGGAAGTAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943152453 2:184131854-184131876 GTCTACCAGCAGATGGAGGTTGG - Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943640378 2:190351467-190351489 GTGTCCTTGGAGAAGAAGGTGGG - Intronic
943910277 2:193556442-193556464 ATGTATTTTCAGAAGGAGGTAGG - Intergenic
944707364 2:202304589-202304611 GTTTACATGCAAAACAAGGTAGG + Intergenic
948138962 2:235659069-235659091 GTGGACTTGCAAAAGGAGGCTGG - Intronic
948546937 2:238739347-238739369 GTGTATATGCAAAAGAAGATAGG - Intergenic
948768958 2:240237679-240237701 GTGTAAATGCAGTAAGAGGCAGG - Intergenic
948883569 2:240872190-240872212 GTGAACATGCAGGCGGAGGAGGG + Intronic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883588 2:240872315-240872337 GTGAACATGGAGGAGGAGGAGGG + Intronic
948883593 2:240872347-240872369 GTGAACATGCAGGCGGAGGAGGG + Intronic
948883598 2:240872379-240872401 GTGAACATGCAGGTGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1170171575 20:13419290-13419312 GTGTGCATGTAGAGGGAGGAGGG + Intronic
1170569855 20:17626618-17626640 GGGTCCATGCAGCAGTAGGTGGG - Intronic
1170733638 20:18994915-18994937 GTCTCCTGGCAGAAGGAGGTGGG - Intergenic
1171163759 20:22952537-22952559 GTGTACCTGTAGAAGGATCTGGG + Intergenic
1171305116 20:24098540-24098562 GTCAAAATGCAGAAGGAGGCCGG - Intergenic
1177561428 21:22759291-22759313 GAGTACCTGAAGAAGGATGTTGG - Intergenic
1180068725 21:45425519-45425541 GTGTTCATGCAGGAGGGTGTGGG - Intronic
1180136736 21:45866821-45866843 GTGCACATGCAGACGGGGGTGGG - Intronic
1180254021 21:46610233-46610255 GTGGACATGCAGAAGGAGCTGGG - Intergenic
1180988562 22:19919933-19919955 GTGAACATGCAGGGGCAGGTGGG - Intronic
1181064237 22:20298292-20298314 GTGCACAGGGAGAAGCAGGTGGG + Intergenic
1185048235 22:48539896-48539918 GGGTACAGGCAGAAGGTGGGAGG + Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
951129211 3:19022011-19022033 GTGTATTTGGAGAAGCAGGTAGG - Intergenic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
954745018 3:52782838-52782860 GTGGACAAGCAGGAGGAGATAGG - Intronic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955370822 3:58350298-58350320 GTGTCCATGTAGTAGGAGGTAGG + Intronic
955723111 3:61904255-61904277 GTCTCCATCCAGAAGGAGCTGGG + Intronic
956253639 3:67261136-67261158 GTGTATATCCAGTAGGAGCTGGG - Intergenic
956730179 3:72189299-72189321 GTGTAGTTGGAGATGGAGGTAGG - Intergenic
957359952 3:79142145-79142167 GTGTGCATGCAGAAGGAGTGAGG + Intronic
959144938 3:102533183-102533205 GACTACATGGAGAAGGAGGGAGG - Intergenic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
960545351 3:118907938-118907960 GTGTACATGAAGAGGGAGATAGG - Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961296125 3:125886112-125886134 GTGTTTATGCAAAAAGAGGTTGG + Intergenic
961746199 3:129064915-129064937 GTGTGCTTGCATTAGGAGGTGGG - Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
964166791 3:153716810-153716832 GTGTGTATGCACAAGGAGGCAGG - Intergenic
966103407 3:176304538-176304560 ATGTACATGTAGGAGGAGGGAGG + Intergenic
969702982 4:8777867-8777889 GTGGACATGACGATGGAGGTCGG - Intergenic
969753862 4:9134627-9134649 GTGTTTATGCAAAAAGAGGTTGG + Intergenic
970567204 4:17343277-17343299 GGGTAAATGCAGTAGGAGTTAGG + Intergenic
971146036 4:23977269-23977291 GTGCACATGCAGAGGAAGGTGGG - Intergenic
971533858 4:27722991-27723013 GTGCACATGCAGAGGGAGAAAGG + Intergenic
972237929 4:37155568-37155590 GTGTACATGCAGAGACAGCTGGG - Intergenic
972569066 4:40294447-40294469 GTGGAGATGGAGATGGAGGTGGG - Intergenic
974851032 4:67405170-67405192 TTTATCATGCAGAAGGAGGTTGG - Intergenic
977616065 4:99088684-99088706 GTGAACATGGCGAACGAGGTAGG - Exonic
977655739 4:99518790-99518812 GTGGAAATCCAGACGGAGGTGGG - Intronic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
983743870 4:171169715-171169737 GCCTTCATGGAGAAGGAGGTCGG + Intergenic
984652607 4:182286550-182286572 CTGTAGATGCAGAAGGTTGTGGG + Intronic
985851727 5:2393359-2393381 GTGGACCTGCAGAAGGGGGTGGG + Intergenic
986063792 5:4216286-4216308 GTGCACAAGCAGCAGGGGGTGGG + Intergenic
987685405 5:21193147-21193169 GTGTATAGACAGAAAGAGGTTGG - Intergenic
990639693 5:57768748-57768770 TTGTACATGCAAGAGGACGTTGG + Intergenic
992311154 5:75500073-75500095 GTGTACATGCAGACAGAGATTGG + Intronic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
993316068 5:86407922-86407944 GTGTACATGCAGAGACAGGAAGG + Intergenic
994641009 5:102410065-102410087 GTGTCCAGGAAGAATGAGGTAGG + Intronic
995090160 5:108165274-108165296 GTGTAATTACAGAAGGAAGTGGG + Intronic
995739706 5:115342854-115342876 GTGGATATGCAGAAGGAGTGGGG + Intergenic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1002604780 5:180376154-180376176 GTGCACATGCAGGTGGAGGATGG - Intergenic
1006255656 6:32830160-32830182 GTGTTCATTCTGAGGGAGGTAGG - Intronic
1006983110 6:38161511-38161533 GTGTACATGCAACAGCAGGGTGG + Intergenic
1010432065 6:75788840-75788862 GTGGACCTGAGGAAGGAGGTGGG + Intronic
1010639670 6:78308970-78308992 ATGTACATACAGAGGCAGGTAGG - Intergenic
1011623414 6:89263838-89263860 GTGTAGCTGCAGAAGGAAATTGG - Intronic
1011937541 6:92799731-92799753 GTTGGCATGAAGAAGGAGGTTGG - Intergenic
1012255301 6:97024366-97024388 GTGAACATGAAGAAGTATGTGGG + Intronic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1012533017 6:100261328-100261350 GTGGACAATCAGAAGGATGTGGG - Intergenic
1015146336 6:129991601-129991623 ATGTACTTGGAGAAGGTGGTAGG - Intergenic
1015326981 6:131934176-131934198 ATGTACAAGAGGAAGGAGGTGGG + Intergenic
1015538750 6:134293917-134293939 GTGTACATCCAGAAGGTGCTAGG + Intronic
1016472920 6:144393701-144393723 TAGAACAGGCAGAAGGAGGTGGG + Intronic
1016914783 6:149234568-149234590 AGGTACATGCGGCAGGAGGTGGG - Intronic
1017281603 6:152631734-152631756 GGGTATAGGTAGAAGGAGGTGGG + Intronic
1017618045 6:156265879-156265901 GTTAACATGCAGATGGAGGGAGG + Intergenic
1018057366 6:160063799-160063821 GAGTACATACTGAAGGATGTTGG + Intronic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019135383 6:169904629-169904651 GTGCCCCTGCAGGAGGAGGTGGG - Intergenic
1019154347 6:170029225-170029247 GTGTCCTTGCAGCAGGAGGCTGG + Intergenic
1019978819 7:4606037-4606059 TTGTCCTTTCAGAAGGAGGTTGG - Intergenic
1022039066 7:26562812-26562834 CTTTACTTGCAGATGGAGGTTGG - Intergenic
1022810100 7:33860177-33860199 TTGCACATGGAGAAAGAGGTTGG + Intergenic
1023467846 7:40477428-40477450 GTATACATGCAAAAGCGGGTTGG + Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1027587607 7:80077321-80077343 GTATTAATGCAGAAGTAGGTAGG - Intergenic
1029204450 7:98860529-98860551 GTGTTCATGCAGCAGGGGGAGGG - Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029321385 7:99763823-99763845 TGGTACATGGAGAAGGAGGGAGG - Intronic
1030375162 7:108745657-108745679 ATGCACCTGCAGAAGGTGGTTGG + Intergenic
1030713032 7:112775170-112775192 CTGTACCTGCAGAAGTTGGTGGG + Exonic
1032811335 7:135421270-135421292 GTGAACATGCTTAAGGAGATAGG - Intronic
1034257492 7:149732671-149732693 GAGTAAAAGCAGAAGGGGGTGGG + Intronic
1034500338 7:151446713-151446735 GTGGGCATGGAGAAGGAAGTGGG - Intergenic
1035417602 7:158703776-158703798 GTGTCCATGAGGAAGGAGTTTGG - Intronic
1035520262 8:270626-270648 GTGTTCCTGGAGAAGGAAGTCGG + Intergenic
1038397146 8:27254979-27255001 GTGTGCATGCATATGTAGGTGGG + Intronic
1042694734 8:71544357-71544379 GTATTCATGCAGAAGCAGATTGG - Intronic
1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG + Intergenic
1044113967 8:88311448-88311470 GTGTGAATGCATAAGGAGATAGG + Intronic
1045494848 8:102699668-102699690 GTGTCCTTGCCGAAGGAGGAAGG + Intergenic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1049632649 8:143666925-143666947 ATGTACATGCACACGGAGGAGGG - Intergenic
1050213113 9:3287302-3287324 GTGAGCATGCAGAATTAGGTAGG - Intronic
1055732119 9:79288886-79288908 GTGTACATGGAGCAAGTGGTGGG + Intergenic
1055791660 9:79929067-79929089 CTGGGCATGAAGAAGGAGGTGGG - Intergenic
1059687648 9:116652792-116652814 GTGCACATGAAGAAAGAGGCAGG - Intronic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1185550651 X:980746-980768 GTGTCCATGGAGGAGGAGGAGGG + Intergenic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187411896 X:19058337-19058359 GTACACAAGCAGAAGGAGATGGG - Intronic
1190097943 X:47497470-47497492 CTGAACTTTCAGAAGGAGGTGGG - Intergenic
1190620633 X:52284119-52284141 GTGTCCAGGAAGAAGGAGGTAGG + Intergenic
1192434556 X:71135080-71135102 CTGTGCCTGCAGAAGGAGTTGGG + Exonic
1193632865 X:83911295-83911317 GTGTTAAAGCAGAAGGACGTTGG - Intergenic
1195421863 X:104684473-104684495 GTGTCCCTGCAGGAGGAGATTGG - Intronic
1196083415 X:111658486-111658508 GTATAAATGCAGAAGGATGCTGG + Intergenic