ID: 960363250

View in Genome Browser
Species Human (GRCh38)
Location 3:116739879-116739901
Sequence TTGAATTAACCAGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960363244_960363250 20 Left 960363244 3:116739836-116739858 CCCCTTCTCCTAATGTATTTAAA 0: 1
1: 0
2: 0
3: 29
4: 361
Right 960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG 0: 1
1: 0
2: 1
3: 21
4: 206
960363248_960363250 12 Left 960363248 3:116739844-116739866 CCTAATGTATTTAAAGTGATGGA 0: 1
1: 0
2: 4
3: 25
4: 256
Right 960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG 0: 1
1: 0
2: 1
3: 21
4: 206
960363246_960363250 18 Left 960363246 3:116739838-116739860 CCTTCTCCTAATGTATTTAAAGT 0: 1
1: 0
2: 0
3: 31
4: 285
Right 960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG 0: 1
1: 0
2: 1
3: 21
4: 206
960363245_960363250 19 Left 960363245 3:116739837-116739859 CCCTTCTCCTAATGTATTTAAAG 0: 1
1: 0
2: 2
3: 32
4: 295
Right 960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG 0: 1
1: 0
2: 1
3: 21
4: 206
960363243_960363250 21 Left 960363243 3:116739835-116739857 CCCCCTTCTCCTAATGTATTTAA 0: 1
1: 0
2: 2
3: 22
4: 289
Right 960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG 0: 1
1: 0
2: 1
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960363250 Original CRISPR TTGAATTAACCAGGAAACAC AGG Intronic
908015931 1:59835980-59836002 TTCAACTAAGCAGGAAACGCAGG + Intronic
910342902 1:86208413-86208435 TTTAACTCTCCAGGAAACACTGG - Intergenic
911062713 1:93761750-93761772 TGGAATTAAACAGGATCCACAGG - Intronic
912647379 1:111406692-111406714 CTGAACTGAGCAGGAAACACAGG + Intergenic
913206435 1:116543492-116543514 TTAAAATGACCAAGAAACACTGG + Intronic
914227535 1:145733541-145733563 TTGAATTAACTAGGAACCATAGG - Intronic
918999175 1:191806544-191806566 TAAAATTAACTAGGAAAAACTGG - Intergenic
920751808 1:208685322-208685344 TTGATTTAAGCAGAAAAGACAGG + Intergenic
921497736 1:215861639-215861661 GGGTATTAACCAGAAAACACTGG - Intronic
921583835 1:216925633-216925655 TTGAATAAACCAGGAAAAGAAGG - Intronic
923662721 1:235972351-235972373 TTGATTTAACAGGGAAAAACAGG - Intergenic
1063608875 10:7546406-7546428 TTGCATTACCCAGGAAGCCCAGG + Intergenic
1063817570 10:9793431-9793453 TTAAAGTAACCAAGAAATACTGG + Intergenic
1066026820 10:31366212-31366234 TTGAATATACCAGGACAGACTGG + Intronic
1066342314 10:34547817-34547839 TTAAATTAACCAGCAAATTCTGG + Intronic
1068234267 10:54212569-54212591 TTAAATTAATCTGGAAACTCAGG - Intronic
1068282767 10:54897228-54897250 TTGAATAAACCAGCAAATAGTGG + Intronic
1068758654 10:60682831-60682853 TATAATAAACCAGTAAACACAGG + Intronic
1070717940 10:78736069-78736091 TTGTATTAGCAAGGAAACAAAGG + Intergenic
1071098063 10:82002343-82002365 TTGAATAAAACAGGAATCAAAGG - Intronic
1072408653 10:95179774-95179796 TTAAAGTAACCAGTAAACCCAGG - Intergenic
1073858635 10:107709167-107709189 TTGAATTAACTAGGATAGATAGG - Intergenic
1076203891 10:128579640-128579662 TGGACTTAACCAGTAACCACTGG + Intergenic
1077149488 11:1063756-1063778 TCAAAATAACCAGGAAACATAGG - Intergenic
1077893849 11:6439356-6439378 TTTACTGAAACAGGAAACACAGG + Intronic
1078483217 11:11698201-11698223 ATAATTTAATCAGGAAACACAGG - Intergenic
1080043372 11:27783117-27783139 TTGAGTTAAAGAAGAAACACAGG - Intergenic
1081041523 11:38220382-38220404 TTGAATTTACCAGATAACCCAGG + Intergenic
1081192597 11:40122077-40122099 TTGAATTTTCCATGAAAGACTGG - Intronic
1082921246 11:58496764-58496786 TTGAAGTAAGCAGAAAACAGTGG - Intergenic
1083108792 11:60385099-60385121 TTGAAATCAACAGGCAACACAGG - Exonic
1083120420 11:60507016-60507038 TTGGAATAACCAGGACAGACTGG - Exonic
1085065762 11:73494373-73494395 TTGAACTAACCAATAAGCACAGG - Intronic
1085128919 11:74021056-74021078 TTCAATTAAACAGGAAATTCTGG - Intronic
1085677624 11:78539248-78539270 TTGAATTAAACTGGTAACATTGG + Intronic
1087639285 11:100738347-100738369 TTGAAATAACCAGGAGAAATTGG + Intronic
1088027315 11:105201146-105201168 TTTAAATAACCAGGAAATACTGG - Intergenic
1091877296 12:3946347-3946369 TTGATTGAAATAGGAAACACTGG - Intergenic
1092602471 12:10082073-10082095 TGGAATTAAAGAGGAGACACAGG + Intronic
1093055746 12:14554081-14554103 ATGAATTAAGCAGGAGACAAGGG - Intronic
1093804394 12:23414349-23414371 TTGAACTAAATAGGAAAAACCGG + Intergenic
1095188661 12:39230947-39230969 TTGAACTAAAATGGAAACACTGG - Intergenic
1097606292 12:61758649-61758671 GTGAATTTACCAGGAAAGAGTGG + Intronic
1097719164 12:63001728-63001750 TTGAAATAACCATGAAAGAGGGG - Intergenic
1100177021 12:92042518-92042540 TTGCATTAACTAGCTAACACAGG + Intronic
1102627610 12:114248004-114248026 TTGGATTACCCAGGAAAGTCAGG + Intergenic
1107441502 13:40431438-40431460 TGGAATTTTCCAGGAAACTCAGG - Intergenic
1108171291 13:47744751-47744773 TTGAATTAAACCGGAAATAGCGG + Intergenic
1109253459 13:60049328-60049350 TAGATTTAACCAATAAACACTGG + Intronic
1109827543 13:67742004-67742026 TTGAATTAAGCAGGACAAATGGG + Intergenic
1111746514 13:92277071-92277093 TTGAATTAACCAGGCATAATTGG - Intronic
1112009098 13:95279076-95279098 TAAAATGCACCAGGAAACACAGG + Intronic
1113183933 13:107664471-107664493 TTGCATTAAATAGGAAACAATGG - Intronic
1113835748 13:113327472-113327494 TTGAATTAACAAGAACAGACTGG - Intronic
1115207811 14:30930790-30930812 TTGAATATACCAAGAAAAACGGG + Intronic
1115939468 14:38592016-38592038 TTGAGGTAAACAGGAAACATTGG + Intergenic
1116240273 14:42333223-42333245 TTGAATGAACAATTAAACACAGG + Intergenic
1116664367 14:47756158-47756180 TTGAATGAACAAGGAAACTATGG - Intergenic
1121088164 14:91162593-91162615 TTTAATTAAAAAGGAAACAAAGG + Intronic
1124886780 15:33694607-33694629 GTGAATTAACCAGGAGATGCAGG + Intronic
1127845709 15:62868729-62868751 TTGAACTAAGCAAGAAATACAGG + Intergenic
1130206251 15:81878488-81878510 TTAAAATAAGCAAGAAACACTGG + Intergenic
1133276876 16:4643889-4643911 ATGAATTAACCAGGAGAAAAAGG - Intronic
1134259669 16:12640824-12640846 TTCCATGCACCAGGAAACACAGG - Intergenic
1138313054 16:56044569-56044591 TTGAAAGAACTAGGAACCACTGG + Intergenic
1140658113 16:77161040-77161062 CTCAATTAACCAGGAAATTCAGG - Intergenic
1141343836 16:83227578-83227600 TTCAATTAAACAGGAAGCAGTGG - Intronic
1145749035 17:27342046-27342068 TTGAAGTAACAAGAAAACATTGG - Intergenic
1203170485 17_GL000205v2_random:144299-144321 ATGAATCAACCAGGAAAAATGGG + Intergenic
1153972075 18:10236080-10236102 TTGTTTTAACCAGGAAATACAGG - Intergenic
1155390590 18:25331746-25331768 TTGTTTGAATCAGGAAACACTGG + Intronic
1155681823 18:28496326-28496348 TTGAATTAAGGAGGTAGCACTGG + Intergenic
1156381687 18:36567494-36567516 TTGAATTCATCGGGAAAGACAGG - Intronic
1157839678 18:50945021-50945043 TTGTACTAAACAGGAAAAACAGG - Intronic
1158296881 18:56007913-56007935 TTAAATTAACCAAAAAACGCAGG - Intergenic
1159197035 18:65130213-65130235 TTTAAGTAACAAGGTAACACTGG + Intergenic
1159856860 18:73599102-73599124 TTAAATGAACCACCAAACACAGG - Intergenic
1160053778 18:75460925-75460947 TTGTATAGACCAGGAAACCCAGG - Intergenic
1160367869 18:78344148-78344170 TTAAATAAACCAGTAAACACAGG + Intergenic
1167264346 19:48476120-48476142 TTACATTTACCAGGAAACCCTGG - Intronic
927370546 2:22349929-22349951 TTGATTTATTCAGGAAACAATGG - Intergenic
928092682 2:28385258-28385280 TTGCATTAACCAGAGAACCCGGG + Intergenic
929125941 2:38522932-38522954 GTGAATTAAACAGGGCACACGGG - Intergenic
930366979 2:50452137-50452159 TTGAATTAATCCTGAGACACAGG - Intronic
931289860 2:60862853-60862875 TAGAATGAAACAGGAAACACTGG - Intergenic
931454170 2:62394245-62394267 TTGAACTAACCTTGTAACACAGG - Intergenic
931465829 2:62486138-62486160 CTGAATTGACCAGGAAAGAATGG + Intergenic
933273317 2:80257021-80257043 TTTAACTAAAGAGGAAACACTGG - Intronic
935922037 2:108026242-108026264 TTGCAGTAAAAAGGAAACACAGG - Intergenic
936522202 2:113218366-113218388 TTTAATGAACCATGAAAGACAGG - Exonic
936989340 2:118346002-118346024 CAGAATTGACCAGGAAAAACTGG - Intergenic
937889704 2:126928550-126928572 TAAAATTAACAAAGAAACACTGG - Intergenic
937999054 2:127717800-127717822 TTGAATTATCCCAGAAACTCAGG + Intronic
939217589 2:139259800-139259822 TTAAATGAGTCAGGAAACACAGG + Intergenic
939768408 2:146283356-146283378 TTGTATTTATCAGGATACACTGG + Intergenic
942483527 2:176415517-176415539 TTGAACTCACCAGGAGACCCAGG + Intergenic
943002395 2:182345016-182345038 TAGAATCAACCAGGATACCCTGG + Intronic
943232931 2:185279009-185279031 TTGTATTACCCAGTCAACACTGG + Intergenic
943658159 2:190530800-190530822 TAGAATTAACCAGCAATAACTGG - Intronic
944719501 2:202408792-202408814 TTGAACTATCTTGGAAACACAGG + Intronic
944832880 2:203550260-203550282 TTGAATTAATCAGCATGCACGGG - Intergenic
1169012417 20:2261460-2261482 TTGAATTACCCAGGAAGAAAGGG + Intergenic
1169156122 20:3331360-3331382 TTAAATAAGCCAGGAAACTCTGG - Intronic
1170010591 20:11718374-11718396 TTGGATTAAACAAGAAAAACAGG - Intergenic
1170518048 20:17152443-17152465 TAGAATGAGCCAGGAAACAAAGG - Intergenic
1172378031 20:34462079-34462101 TTTAATTGACTACGAAACACAGG - Exonic
1172673991 20:36654497-36654519 TTGAATTAACCTCCAGACACAGG - Intronic
1173339477 20:42140773-42140795 TTTTATTAACCAGGATTCACTGG - Intronic
1176326476 21:5506130-5506152 ATGAATCAACCAGGAAAAATGGG + Intergenic
1176331237 21:5550075-5550097 ATGAATCAACCAGGAAAAATGGG - Intergenic
1176396520 21:6270876-6270898 ATGAATCAACCAGGAAAAATGGG + Intergenic
1176401281 21:6314821-6314843 ATGAATCAACCAGGAAAAATGGG - Intergenic
1176435876 21:6674283-6674305 ATGAATCAACCAGGAAAAATGGG + Intergenic
1176440637 21:6718228-6718250 ATGAATCAACCAGGAAAAATGGG - Intergenic
1176460138 21:7001353-7001375 ATGAATCAACCAGGAAAAATGGG + Intergenic
1176464899 21:7045297-7045319 ATGAATCAACCAGGAAAAATGGG - Intergenic
1176483699 21:7383131-7383153 ATGAATCAACCAGGAAAAATGGG + Intergenic
1176488460 21:7427076-7427098 ATGAATCAACCAGGAAAAATGGG - Intergenic
1178273833 21:31218136-31218158 TAGATTTAACCTGGAAACCCAGG - Intronic
1181791410 22:25269956-25269978 TTAAATTAATCAGGAAAAAAGGG - Intergenic
1181827105 22:25526067-25526089 TTAAATTAATCAGGAAAAAAGGG - Intergenic
1183366522 22:37409878-37409900 TTGTAGGTACCAGGAAACACGGG + Intronic
949719875 3:6976488-6976510 TTGCAGAAACCAGGTAACACTGG - Intronic
949757095 3:7424514-7424536 TTGTATTAACCTGTAAAAACAGG - Intronic
951316751 3:21196574-21196596 TTGAAGTAATTTGGAAACACTGG - Intergenic
951765273 3:26190847-26190869 TTCAATACAGCAGGAAACACTGG - Intergenic
951843765 3:27063347-27063369 TTGGAGTAACCAGGAAACCTGGG - Intergenic
956083314 3:65582652-65582674 TTGAAGTAACCAGGATGCAAAGG - Intronic
956545886 3:70402005-70402027 TTTAAGTAACCTGGAAAAACAGG - Intergenic
957081026 3:75635589-75635611 ATGAATCAACCAGGAAAAATGGG - Intergenic
957891330 3:86363044-86363066 TTGACTCAACAAGGAAACAAGGG - Intergenic
958268806 3:91472478-91472500 TTAAATTAAACAGAAAACATAGG + Intergenic
958544271 3:95521551-95521573 TAAAATTAAACAGGAAAGACAGG - Intergenic
960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG + Intronic
960595326 3:119403073-119403095 TTTAATTAACAAGCAAACATGGG + Intronic
960794367 3:121469692-121469714 TTGAATTAATGAAGCAACACTGG + Intronic
960926913 3:122803482-122803504 CTGATTTAAACAGGAAAAACAGG + Intronic
962863520 3:139426468-139426490 GTGAAGTAGCCAGAAAACACTGG - Intergenic
963085586 3:141432755-141432777 TTTAATTAAGCTGGAAATACTGG + Intronic
963826039 3:149954883-149954905 TTGAATGACACAGGAAATACAGG - Intronic
964198894 3:154095326-154095348 TTAAAATATCCAGGGAACACAGG + Intergenic
964850687 3:161093127-161093149 TTGGATTAACCAGTCAGCACAGG + Intronic
971083150 4:23239076-23239098 TTAAATTAACTTGGAAACAATGG + Intergenic
974081259 4:57215668-57215690 TTGAATTAAGAAGGAATCTCTGG - Intergenic
976314532 4:83645154-83645176 TGGAATTATCCAGGCCACACTGG - Intergenic
978948785 4:114530775-114530797 GAGAATTAATAAGGAAACACTGG + Intergenic
980092318 4:128455589-128455611 CAAAATTAACCAGGAAATACAGG - Intergenic
980901579 4:138910394-138910416 TTGATTTAACCTGGCAACCCAGG + Intergenic
982432764 4:155341027-155341049 CTGAATGAACCAGTAAACACTGG + Intergenic
985292003 4:188395595-188395617 CTGAATTCACCATGGAACACGGG - Intergenic
985380608 4:189390973-189390995 TTGAAATATGCCGGAAACACAGG + Intergenic
990189047 5:53237676-53237698 TTGAATGAAGCAGTAAATACAGG + Intergenic
990516909 5:56538932-56538954 TTGAATTAGACAGAAAATACAGG + Intronic
991159753 5:63484058-63484080 TTGCTTCAACCAGGAAACAGAGG + Intergenic
991470284 5:66961456-66961478 TTGGATTTATCAGTAAACACAGG + Intronic
991627001 5:68613144-68613166 CAGAATTAACAAGGAAACATTGG + Intergenic
991982191 5:72243932-72243954 TTAAATTGACCAGCAAACCCTGG - Intronic
992214924 5:74516507-74516529 TAGGAATAACCAGGAAATACTGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993846509 5:92951113-92951135 GAAAATTAACAAGGAAACACTGG - Intergenic
994245301 5:97470544-97470566 TTGAAGACACCAGGAACCACAGG + Intergenic
995340346 5:111051544-111051566 TTGAACAAAACAGGTAACACTGG + Intergenic
995911040 5:117186979-117187001 TTCAATTAACCAGACCACACTGG + Intergenic
1000960945 5:167600215-167600237 TAGAATAAAACAGGAAATACAGG - Intronic
1003829934 6:9997059-9997081 TTTCTTTCACCAGGAAACACAGG - Intronic
1005626973 6:27671752-27671774 TTGTATAAACGAGGAAACAGAGG - Intergenic
1008986426 6:57549243-57549265 TTAAATTAAACAGAAAACATAGG - Intronic
1009174386 6:60441815-60441837 TTAAATTAAACAGAAAACATAGG - Intergenic
1009819379 6:68780287-68780309 ATGAATTAACCATGAGGCACTGG - Intronic
1011056699 6:83212604-83212626 TAGAATTATGCATGAAACACAGG - Intronic
1014048014 6:116916043-116916065 TTGCATTGTCCAGGATACACTGG - Exonic
1015336271 6:132042854-132042876 TTGAAATAACCAGGAATCACTGG - Intergenic
1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG + Intronic
1018231181 6:161677165-161677187 GTGAGTTATCCAGGAAACAGGGG + Intronic
1018524677 6:164695650-164695672 AAGAATTATCCAAGAAACACTGG + Intergenic
1019858969 7:3638945-3638967 TAGATATAACCATGAAACACTGG + Intronic
1021681064 7:23132745-23132767 ATGAAATAACAAGAAAACACTGG - Intronic
1024603397 7:51006528-51006550 GTGAATTCAACAGGAAACACTGG + Intergenic
1029336712 7:99906587-99906609 TTAAATTTACCAGCAAACAAAGG + Intronic
1031727022 7:125252678-125252700 TTTAATGAAACAGGAAACACAGG - Intergenic
1035155180 7:156906358-156906380 TGGGAGTAACCAGGAAACTCTGG - Intergenic
1035927911 8:3748701-3748723 TAGAATTAACCTGGGAACATGGG + Intronic
1039044251 8:33435598-33435620 TTGCATGAACCAGGAGACAGAGG - Intronic
1039140066 8:34377104-34377126 TTGAAAGAACCAGGAAAGAGTGG - Intergenic
1039243416 8:35581812-35581834 TTTACTGAATCAGGAAACACTGG - Intronic
1040899114 8:52399949-52399971 TAAAATTAATAAGGAAACACTGG - Intronic
1041579699 8:59444805-59444827 TTGTATTAACAACCAAACACAGG + Intergenic
1041600484 8:59711712-59711734 TTCACTCAACCAGGTAACACTGG - Intergenic
1042444762 8:68871188-68871210 CTGAACTAGCCAGGAAACAGGGG - Intergenic
1043405699 8:79930219-79930241 CTTAATTAACTAGGCAACACAGG + Intronic
1045517407 8:102872276-102872298 TATAATAAACCAGTAAACACAGG - Intronic
1048864787 8:138751977-138751999 ATCAATTAACCAAGGAACACTGG + Intronic
1050457737 9:5849655-5849677 TTTTATTAACCAAGAATCACAGG - Intergenic
1052524538 9:29597369-29597391 TTGATTTAACAAGGTAACCCAGG + Intergenic
1053433977 9:38063069-38063091 GGGAATCAACCAGGAAAAACTGG + Intronic
1054451758 9:65407044-65407066 TTGGATTCTCCAGGAAGCACTGG + Intergenic
1055686067 9:78776107-78776129 GAGAAATAAACAGGAAACACGGG + Intergenic
1057600388 9:96451444-96451466 TTCAAGAAAACAGGAAACACAGG - Intronic
1057680651 9:97179842-97179864 ATGAATCATCCAGGAAATACAGG - Intergenic
1061556963 9:131376600-131376622 TTGTGTTAACAAGGAAACACAGG - Intergenic
1203430865 Un_GL000195v1:90252-90274 ATGAATCAACCAGGAAAAATGGG + Intergenic
1203435644 Un_GL000195v1:134377-134399 ATGAATCAACCAGGAAAAATGGG - Intergenic
1203671502 Un_KI270755v1:18231-18253 TGGCATCAACAAGGAAACACAGG - Intergenic
1186270935 X:7887230-7887252 ATGAATTTACTAGGAAGCACTGG + Intergenic
1187836882 X:23440259-23440281 TTCAAGTACCCAGAAAACACAGG + Intergenic
1187848835 X:23570357-23570379 TTGAATTAAGGAAGAAACACTGG - Intergenic
1188578721 X:31684514-31684536 TTGAATTAACCACTAAAGCCAGG - Intronic
1188872905 X:35396467-35396489 TTTTATTGACCAAGAAACACAGG - Intergenic
1188876145 X:35432376-35432398 TAAAATTAACCTGGAAACACAGG + Intergenic
1190915171 X:54806375-54806397 TTGAATTATCCATGGAACACAGG + Intergenic
1190950206 X:55136042-55136064 TTGAATGAACCAGAAAAGAAAGG - Intronic
1191587815 X:62848189-62848211 TTGTATTAACCAGGATTCTCTGG - Intergenic
1192804936 X:74500210-74500232 TTGGATGAAGGAGGAAACACGGG + Intronic
1197270554 X:124420359-124420381 ATGACCTATCCAGGAAACACAGG - Exonic
1197280471 X:124529698-124529720 TTGAATTAATTAGGAAATAGAGG + Intronic
1199662315 X:150064134-150064156 TTATATTAACCAGGAATAACAGG - Intergenic
1201611804 Y:15851551-15851573 TTGCCTTACCCAGGAAGCACAGG + Intergenic
1201857704 Y:18563788-18563810 TTGAATTAACCAGGAGTCTTGGG + Intronic
1201859684 Y:18583365-18583387 CTGAATTAACCAGGAATCCAGGG + Intronic
1201873637 Y:18737016-18737038 CTGAATTAACCAGGAATCCAGGG - Intronic
1201875617 Y:18756593-18756615 TTGAATTAACCAGGAGTCTTGGG - Intronic
1202167372 Y:22004279-22004301 TTGAATTAACCAGGAATCCAGGG - Intergenic
1202169314 Y:22024219-22024241 TTGAATTAACCAGGAATCTAAGG - Intergenic
1202222048 Y:22562146-22562168 TTGAATTAACCAGGAATCTAAGG + Intergenic
1202223988 Y:22582090-22582112 TTGAATTAACCAGGAATCCAGGG + Intergenic
1202319127 Y:23613571-23613593 TTGAATTAACCAGGAATCCAGGG - Intergenic
1202321067 Y:23633521-23633543 TTGAATTAACCAGGAATCTAAGG - Intergenic
1202549700 Y:26036535-26036557 TTGAATTAACCAGGAATCTAAGG + Intergenic
1202551642 Y:26056486-26056508 TTGAATTAACCAGGAATCCAGGG + Intergenic