ID: 960363514

View in Genome Browser
Species Human (GRCh38)
Location 3:116743206-116743228
Sequence TTGGTTAAATACATGTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960363514_960363517 -7 Left 960363514 3:116743206-116743228 CCTTGCCACATGTATTTAACCAA 0: 1
1: 0
2: 1
3: 29
4: 201
Right 960363517 3:116743222-116743244 TAACCAATCATAATGGTCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960363514 Original CRISPR TTGGTTAAATACATGTGGCA AGG (reversed) Intronic
902436564 1:16401769-16401791 TTGGGTAACTACAGGTTGCAGGG - Intronic
902640955 1:17765845-17765867 TGGGTTCATTACATCTGGCATGG + Intronic
904161815 1:28527713-28527735 TTTTTTAAATACATGTGGCCAGG + Intronic
908527295 1:65000594-65000616 TTGGTTAAATAAATGTACAATGG + Intergenic
908609191 1:65837134-65837156 TTGTTTATATACATGTGTCTAGG - Intronic
909227292 1:73041924-73041946 TTGATTAAATAAATTTGGCATGG + Intergenic
909367315 1:74842270-74842292 TTTGTTAAATACAAGTTACATGG - Intergenic
912165172 1:107034874-107034896 TTGCTTATATACAGGTGCCATGG - Intergenic
915203236 1:154249559-154249581 TAGGGGAAATACATGTGGGAAGG - Intronic
916661585 1:166926779-166926801 TTGGTTCTATCCATGGGGCATGG + Intronic
916966327 1:169946356-169946378 TTGATTTAATACATTTGACATGG - Intronic
918485026 1:185019671-185019693 TTGGATGAATAAATGTAGCAGGG + Intergenic
918518189 1:185385630-185385652 TTGTTCAAAGACATCTGGCAAGG + Intergenic
920710723 1:208292300-208292322 TTGGTGAAGCCCATGTGGCAAGG + Intergenic
921392269 1:214628526-214628548 TTGCTTAAATCCAGGAGGCAGGG - Intronic
923835651 1:237608384-237608406 TTGCTTAAATTCTTCTGGCAAGG - Intronic
1063712568 10:8493842-8493864 TTTGTTGTATACATGTGTCATGG + Intergenic
1068201316 10:53787589-53787611 TTGGTTTTATACATTTTGCATGG - Intergenic
1069245673 10:66202084-66202106 TTGGTTAAAAATAGATGGCAAGG - Intronic
1070091646 10:73291793-73291815 TTGGTTCCATAAATGTGACATGG - Intronic
1070186772 10:74071286-74071308 TTGGTTTAATTCATTTGACAAGG - Intronic
1070418911 10:76217034-76217056 TTGTTTAAATGCATCTGGTATGG - Intronic
1071278349 10:84076915-84076937 TTGGTTAAATGAATGTTGCCAGG - Intergenic
1071287774 10:84164703-84164725 TTATTTAAATTAATGTGGCATGG + Intergenic
1072561184 10:96576193-96576215 TTGATTAGACACATGTGGCCCGG - Intronic
1074699661 10:116082140-116082162 TTGGTTAAAGAGATGTGGCGGGG + Intronic
1077961977 11:7085100-7085122 GTGGTAAAATACATGTAACATGG + Intergenic
1078918392 11:15802784-15802806 TTTGTTACATACATGTGCCGTGG + Intergenic
1079059228 11:17233432-17233454 TTGGAAAAATACATATGGAAAGG + Intronic
1079588932 11:22158712-22158734 TTGGATACTTACATGTGTCAAGG - Intergenic
1081132610 11:39398949-39398971 TGGTTTAAATACATTTGTCAGGG + Intergenic
1082977615 11:59088748-59088770 TTGGTCATATATGTGTGGCATGG - Intergenic
1085727325 11:78965370-78965392 TTGGCTTAATACATGTGGCCTGG - Intronic
1088689886 11:112316612-112316634 TTGGTGAAACACTTGTAGCAAGG - Intergenic
1092673419 12:10888917-10888939 TGAGTTAAATCCATGTGTCAAGG + Intronic
1092711919 12:11347729-11347751 TTGGTTAAATCCATGTGTCAAGG - Intergenic
1092712005 12:11348778-11348800 TGGCTTAAATCCATGTGGAAAGG - Intergenic
1095703423 12:45214102-45214124 TTGGTTAAAGAACTATGGCAGGG + Intergenic
1096585381 12:52616388-52616410 TTGCTTAAGTATGTGTGGCATGG - Intronic
1097906091 12:64921191-64921213 TTGTTTAAACCCAGGTGGCAGGG - Intergenic
1099467704 12:83007017-83007039 TTTGTTACATACATGTGCCATGG - Intronic
1100814153 12:98369458-98369480 TTAGTTAAATACATTTTGTAGGG - Intergenic
1101685679 12:107017690-107017712 TTGGTTAAAAACAAGTTGTAAGG + Intronic
1104703003 12:130921464-130921486 TTGTTTAAAAGTATGTGGCATGG - Intergenic
1106271639 13:28159859-28159881 TGGGTAAATTACATATGGCAGGG - Intronic
1106337138 13:28794272-28794294 TTGGTTACTTAGTTGTGGCAAGG + Intergenic
1106445065 13:29822061-29822083 TTGGTTGAATATATATGGTAGGG + Intronic
1108022577 13:46143684-46143706 TAGGTTAATTGCATGTTGCAGGG - Intronic
1109551860 13:63914618-63914640 TTGGTTACATAAATGTGTTAGGG + Intergenic
1109663259 13:65493568-65493590 TGGGTGAATTGCATGTGGCAGGG - Intergenic
1110465630 13:75797727-75797749 TTGCTATAATACATGTGGCTGGG - Intronic
1111043127 13:82777926-82777948 TGGGTTAAAAAGATGTGGAAAGG - Intergenic
1111410500 13:87871021-87871043 TTGATTAAATATATGGAGCATGG + Intergenic
1111492066 13:88992060-88992082 TAGGTAAAATGCATGTTGCAGGG - Intergenic
1111746156 13:92272201-92272223 TTGGCTAAAAAAATGTGGGAAGG - Intronic
1112107405 13:96256271-96256293 ATGTTTCAATACATGTGACAAGG - Intronic
1112296469 13:98191645-98191667 TTAGTTAAATAAATTTGGCCAGG + Intronic
1112797915 13:103077385-103077407 TTAGTAAAATAAATGTGTCAAGG - Intergenic
1113290102 13:108896062-108896084 ATGGTTAAATGCATGTGCCTGGG - Intronic
1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG + Intergenic
1115894696 14:38073221-38073243 ATGGCAAAACACATGTGGCAAGG + Intergenic
1116997194 14:51336211-51336233 TTGGTTAATGATATGTGCCATGG + Intergenic
1118984763 14:70744273-70744295 TTTGTTACATACACGTGCCATGG - Intronic
1121027525 14:90627458-90627480 TTTGCTAAATAGATGTGGCCTGG - Intronic
1124011082 15:25839233-25839255 TTGGATAATTACAGTTGGCAGGG - Intronic
1125280729 15:38040059-38040081 CTGGAGAAATCCATGTGGCAAGG - Intergenic
1126324257 15:47459196-47459218 TTGGAGAAATCCATGTGGCAAGG + Intronic
1126783176 15:52155719-52155741 TGGGTAAAACACATTTGGCAGGG + Intronic
1127229595 15:56974858-56974880 TTGGTTAAATTTGTGTGGTAAGG + Intronic
1127253402 15:57266410-57266432 ATGGATAAATGAATGTGGCATGG - Intronic
1127541228 15:59940985-59941007 TTGGTTAAAGGTATGTGGCAAGG + Intergenic
1128329029 15:66743891-66743913 TTGGTTAAGTAAATATGGCATGG - Intronic
1129922663 15:79333190-79333212 TTGCTTAAATAAATGTCACAGGG - Intronic
1130143955 15:81257717-81257739 CTGGTTAATTTCATGTGCCAAGG - Intronic
1130242115 15:82203671-82203693 AAGGTTAAAAACATGTGGCCAGG - Intronic
1130302566 15:82690978-82691000 TGGATTAAGAACATGTGGCATGG - Intronic
1130914516 15:88294372-88294394 TTGCTTGAATCCATGAGGCAGGG - Intergenic
1132874919 16:2132779-2132801 TTGGTTCAAAACATGGGTCAGGG + Intronic
1133727521 16:8551221-8551243 TTTGTTAATTTCATGAGGCAGGG + Intergenic
1134520072 16:14914603-14914625 TTGGTTCAAAACATGGGTCAGGG - Intronic
1134553861 16:15151629-15151651 TTGGTTCAAAACATGGGTCAGGG + Intergenic
1134707745 16:16313257-16313279 TTGGTTCAAAACATGGGTCAGGG - Intergenic
1134959798 16:18398868-18398890 TTGGTTCAAAACATGGGTCAGGG + Intergenic
1135748496 16:25037537-25037559 TTGGTTTATTACTTGTTGCAAGG + Intergenic
1135751705 16:25063591-25063613 TTGGTTTATTACTTGTTGCAAGG + Intergenic
1135951389 16:26917692-26917714 TTTGTTACATATATGTGTCATGG + Intergenic
1137776532 16:51059503-51059525 TTGGTTAAATACATTTCCTAAGG + Intergenic
1139115331 16:63944292-63944314 TTATTTAAATAGGTGTGGCAGGG - Intergenic
1139800435 16:69518450-69518472 TTGATTAAATAAATGTGTAAGGG + Intergenic
1141150908 16:81564151-81564173 TTGGTCAAATACACCTGCCAGGG + Intronic
1141512158 16:84519427-84519449 TTGGTTAAATGCAGGTTGCCAGG + Intronic
1144286043 17:13775601-13775623 TTGTTCAAATACCTGTGCCATGG + Intergenic
1150171472 17:63000168-63000190 TTGGTAAAATGCGTGTGACAGGG - Intergenic
1153097767 18:1427703-1427725 TTAGTGGAATACATGTGGCTAGG + Intergenic
1155169691 18:23258193-23258215 AGGGTTAAATACACGTGGCGGGG - Exonic
1156834266 18:41533718-41533740 TTGGTTAAGTAAATGTCCCAAGG + Intergenic
1158280376 18:55818962-55818984 TTGGATAAATACATCTGGTATGG + Intergenic
1159315933 18:66773013-66773035 TTGATTACAAAAATGTGGCAGGG - Intergenic
1160257926 18:77263392-77263414 GTGTTTAAATAGATGAGGCATGG + Intronic
1162342248 19:10098489-10098511 TTGCTTTAATACATCAGGCAGGG - Intronic
1164456222 19:28409486-28409508 TTGATTAAACACTTGTGGGAGGG - Intergenic
926158461 2:10471415-10471437 TGTGTTAAATACATGTTGTACGG - Intergenic
926770528 2:16369246-16369268 GTGGTTAAATAAAGCTGGCAAGG - Intergenic
929278663 2:40053814-40053836 TTAGTTAAATACAAATGACAAGG + Intergenic
932967774 2:76498127-76498149 TTTGTTAAATAAATGTGGCTTGG - Intergenic
934607038 2:95703684-95703706 ATGGTTAAATAGTTGTTGCAGGG + Intergenic
935631882 2:105218767-105218789 TTGGGTAAAGTCATGTGGCTAGG + Intergenic
936492907 2:112989238-112989260 TTTGTTACACACATGTGCCATGG - Intergenic
936515814 2:113180733-113180755 ATGGTTAACTGCATGTGGAAGGG + Intronic
937569037 2:123333985-123334007 TTGGTTCAATAGCTCTGGCAGGG - Intergenic
940587225 2:155668563-155668585 TTGGTGAACCACATGTTGCAAGG - Intergenic
942112462 2:172695713-172695735 TTGGGAAAAGACAGGTGGCAAGG + Intergenic
945265480 2:207887312-207887334 TTGGTCAAGTAAATGAGGCATGG - Intronic
1168732034 20:92789-92811 TTGTTTAAATAAATGGGGCATGG - Intronic
1170991728 20:21307747-21307769 TTGGCAAAAGACAGGTGGCAGGG - Intronic
1174914899 20:54644052-54644074 TTGTTCAAATACAGGTGGCCTGG - Intronic
1175469204 20:59214368-59214390 TAGGTTAAATGCATGTGTGATGG + Intronic
1176865902 21:14055006-14055028 TTGGTCAAATACACAGGGCATGG - Intergenic
1177013232 21:15753351-15753373 TTGGGAAAAAACAGGTGGCAAGG + Intronic
1177038486 21:16075102-16075124 TTGGTTAAATAGATTTGGGTGGG + Intergenic
1180819669 22:18817416-18817438 GTGGTTGAATAGATGTGTCACGG - Intergenic
1181205893 22:21251861-21251883 GTGGTTGAATAGATGTGTCACGG - Intergenic
1181908421 22:26218300-26218322 TAGGTACAATACATGTGCCATGG + Intronic
1182325778 22:29511586-29511608 TTGGTTAAAAACGTGTTCCATGG + Intronic
1183548269 22:38467052-38467074 CTGTTTAAATACATTTGTCATGG + Intergenic
1183706056 22:39475511-39475533 TTGGTTAACTACAGGAGGGAGGG - Intronic
1184599683 22:45535852-45535874 TAGGCTAAATGCCTGTGGCAGGG - Intronic
1203221027 22_KI270731v1_random:43552-43574 GTGGTTGAATAGATGTGTCACGG + Intergenic
1203269798 22_KI270734v1_random:43269-43291 GTGGTTGAATAGATGTGTCACGG - Intergenic
949492926 3:4606591-4606613 ATGGTAAAACACATGTTGCAAGG + Intronic
950369967 3:12520834-12520856 ATGGGTAAATTCATGTGACAGGG + Intronic
951137893 3:19125444-19125466 TTGGTTAAGTGGCTGTGGCATGG + Intergenic
951391107 3:22105131-22105153 CTATTTACATACATGTGGCAAGG + Intronic
951830913 3:26925926-26925948 TTGGTTAAATTGATCTGGAAGGG + Intergenic
953593888 3:44288998-44289020 TTTGTTAAATACATGGAGTATGG - Intronic
954853505 3:53623313-53623335 ATGGTGATATACATGTGTCAGGG + Intronic
955657278 3:61258250-61258272 TTGGTAAAGTACATATGGTACGG + Intergenic
956585066 3:70855422-70855444 TTGGCGAAACCCATGTGGCAAGG + Intergenic
956604074 3:71053882-71053904 CTGGATAAATACATGTTGCATGG - Intronic
960363514 3:116743206-116743228 TTGGTTAAATACATGTGGCAAGG - Intronic
962051156 3:131817132-131817154 TTGGTTCACTACATGTGGAAAGG + Intronic
963354371 3:144191917-144191939 TTGCTTAAATAAATGTTCCAGGG - Intergenic
963909070 3:150799753-150799775 GTGGTTAAATAGAGGTGGCTGGG - Intergenic
963966438 3:151376521-151376543 TTGGTTAAATAGATTTTGAAAGG + Intronic
964377418 3:156062975-156062997 CTTGTTACATACATGTGCCATGG + Intronic
964422135 3:156514376-156514398 TTGGTTTATCACATGTGTCATGG - Exonic
972057490 4:34822473-34822495 TTTTTTAAATAAATGTAGCAAGG - Intergenic
972136212 4:35897601-35897623 TAGGTAAATTACATGTGTCATGG - Intergenic
972201135 4:36715979-36716001 ATGGCTAAAGACATGTGGCAGGG - Intergenic
972621451 4:40751119-40751141 TTGGTTAATTGCAAGTGTCAAGG + Intronic
973006496 4:45014018-45014040 TTGAATGAATACATGAGGCAAGG - Intergenic
973095539 4:46194504-46194526 ATCCTTAAATACATGTGACAAGG + Intergenic
975878712 4:78875770-78875792 TTGAAGAAATCCATGTGGCAGGG - Intronic
977792280 4:101121380-101121402 TTGTTTAAATACATTAAGCAAGG - Intronic
978338556 4:107696679-107696701 TTTGTTACATGCTTGTGGCACGG - Intronic
979009494 4:115349714-115349736 TTTGTTACATACACGTGCCATGG + Intergenic
980243920 4:130213229-130213251 ATGGTTTAATACACATGGCAGGG - Intergenic
982058698 4:151580333-151580355 TAGGTTAAATATTTTTGGCAAGG + Intronic
983502296 4:168513000-168513022 TGGGTAAATTACATGTTGCAGGG - Intronic
984064129 4:175027181-175027203 TTGGATAAATACATCTGGTATGG - Intergenic
986058047 5:4158749-4158771 TTTGTTAAATACACGATGCAAGG - Intergenic
986114560 5:4759452-4759474 CTGGATAAATACATCTGGTATGG - Intergenic
987752069 5:22053140-22053162 TTTGTTAAAAATATTTGGCACGG + Intronic
988391321 5:30636563-30636585 TATGTTAAATAGATGTGGCAAGG + Intergenic
989008479 5:36842346-36842368 TTTGTTAAATCCATGAAGCAGGG - Intergenic
989365919 5:40655081-40655103 TTGGTTTCATACATGTTGAAAGG + Intergenic
989738740 5:44742255-44742277 TTGGTGAAATACCCATGGCAGGG - Intergenic
992783234 5:80146753-80146775 CTGTTAAAATAAATGTGGCAGGG - Intronic
993182282 5:84569849-84569871 CTGGATAAACAAATGTGGCATGG - Intergenic
993229665 5:85217819-85217841 ATGGTTAAATAACTTTGGCAAGG + Intergenic
994521242 5:100839213-100839235 CTGGGTAAATACATATTGCAAGG + Intronic
995377193 5:111488340-111488362 TTTGTTAAATCCATGTGTAATGG - Exonic
1000282420 5:159793667-159793689 TTGGCTAAACACATGTTGAATGG - Intergenic
1000663689 5:163968169-163968191 ATGGTTAAATAAATATTGCATGG + Intergenic
1000854952 5:166386237-166386259 TTGATTAAATACAAGGGTCATGG + Intergenic
1003923712 6:10857189-10857211 TTGGTTAAATACTTATGTCTGGG - Intronic
1004057496 6:12154755-12154777 TTTGTTACATACATGTGCCATGG - Intronic
1005055381 6:21723788-21723810 TTGGTCAAATGCAGATGGCATGG + Intergenic
1005491326 6:26349975-26349997 TTTGGTAAATACTTGTGGAATGG - Intergenic
1005503367 6:26449460-26449482 TTGGTTGAATGCTAGTGGCAGGG - Intronic
1007894569 6:45340226-45340248 TTTCTTAAAGATATGTGGCAGGG - Intronic
1009840760 6:69071031-69071053 ATGGTGAAATACATGAGGCAGGG + Intronic
1010051649 6:71511499-71511521 GTGGAGAAATCCATGTGGCAAGG + Intergenic
1010208450 6:73344037-73344059 TTGTTCAAATACTTGTTGCATGG - Intergenic
1011625176 6:89277597-89277619 TTTGTTAAATACATGTGTAATGG - Intronic
1011678577 6:89760233-89760255 TTGGTTAAATATTTGTGGCTTGG - Intronic
1012745488 6:103081830-103081852 TTGGATAAATACATCTGGTATGG + Intergenic
1014257450 6:119176066-119176088 TTTGTTTAACATATGTGGCAGGG + Intergenic
1015148672 6:130015947-130015969 TTTGGTATTTACATGTGGCAGGG + Intronic
1015417671 6:132968225-132968247 TTTGTGAAATTCATGTGGCAAGG + Intergenic
1016914297 6:149230533-149230555 TAGGTCAAGTACATGAGGCAAGG + Intronic
1020409803 7:7878770-7878792 TTTGTTTAATAAATGTGGCATGG + Exonic
1021292225 7:18860433-18860455 TTGGAAAGATACATGTTGCAGGG + Intronic
1021625955 7:22593347-22593369 TTTGTTACATACGTGTGCCATGG + Intronic
1024152220 7:46583590-46583612 TCAGTAAAATACATGTGCCAGGG - Intergenic
1025034631 7:55586347-55586369 TTTATTAAATACTAGTGGCAAGG + Intergenic
1027529089 7:79307708-79307730 TTGGTTAAAAGAATGTGGCCTGG + Intronic
1028034572 7:85965458-85965480 TTGGTTAAGTATTTGGGGCAAGG - Intergenic
1028897070 7:96054048-96054070 TTTGTTATATACACGTGCCATGG + Intronic
1029025583 7:97413734-97413756 TTGGGGAGGTACATGTGGCAAGG - Intergenic
1030004711 7:105106026-105106048 TTGGTTTGAGAAATGTGGCAGGG + Intronic
1031214505 7:118872820-118872842 ATTGTGAAACACATGTGGCAAGG - Intergenic
1031334826 7:120515412-120515434 TTGTTTAAATACATGTGAAAAGG + Intronic
1034219919 7:149436274-149436296 GAGGTTAAATAGATGGGGCAAGG - Intronic
1037602903 8:20413103-20413125 TTGGTTAAATACAAATTGCTGGG - Intergenic
1038270195 8:26068704-26068726 TTGGTTAAAGACAAGTGTTATGG + Intergenic
1046429157 8:114100418-114100440 CTGATTAAACACATGGGGCAGGG - Intergenic
1047868723 8:129058804-129058826 ATGGTTAAATACATATGCCTTGG - Intergenic
1052522561 9:29567306-29567328 TGGGTTAAATATACTTGGCATGG + Intergenic
1054849121 9:69828374-69828396 TTGGTTAAAAATATGTGTCTAGG + Intronic
1056376800 9:86022445-86022467 TTGGTAAAATACATTTAGAAGGG + Intergenic
1057038127 9:91826484-91826506 TGGGTTAAATAAATGTGGCTGGG + Intronic
1060301977 9:122379390-122379412 TTGGATAATTACAGGTGGCATGG - Intronic
1186063273 X:5733883-5733905 TTAATTAAATACATGTTTCATGG + Intergenic
1188132226 X:26450723-26450745 TTGGTTAATTAACCGTGGCAAGG + Intergenic
1188829898 X:34883317-34883339 TTGGTAAAATCTACGTGGCATGG + Intergenic
1189352443 X:40286184-40286206 TTGGTTAGACACATGAGCCATGG + Intergenic
1189366239 X:40391081-40391103 TTGATTAAATGCAGGGGGCAAGG - Intergenic
1190989510 X:55531708-55531730 TTGGGTAAATAAGTGTGGAATGG + Intergenic
1192837845 X:74820960-74820982 TTGGTAAATTGCATGTGGCTGGG - Intronic
1192947300 X:75978857-75978879 TTGGTAAATTACATGTGTCTAGG + Intergenic
1193804763 X:85982131-85982153 TTGGGTTAACAAATGTGGCAAGG + Intronic
1194167446 X:90536377-90536399 TGGGTTAATTGCATGTTGCAAGG - Intergenic
1194715895 X:97286581-97286603 TTGTTAAAATATGTGTGGCATGG - Intronic
1194826247 X:98566267-98566289 TTTGTTAATTACATATGGCAAGG - Intergenic
1196185250 X:112738583-112738605 CTGGTTAAACCCATGTGGCCTGG + Intergenic
1198022897 X:132676639-132676661 TTTTTTAAATGCAGGTGGCAGGG + Intronic
1199103038 X:143828174-143828196 TTGGCTAATAACATGTTGCAAGG - Intergenic
1199598435 X:149526078-149526100 TTGGGTGAAAACATGTGGCTGGG - Intronic
1200513709 Y:4114155-4114177 TGGGTTAATTGCATGTTGCAAGG - Intergenic
1201614603 Y:15883240-15883262 TTGGTTTAATACAAGTGGGAAGG - Intergenic
1201615765 Y:15896537-15896559 TTGGTTTAATACAAGTGGGAAGG + Intergenic