ID: 960364585

View in Genome Browser
Species Human (GRCh38)
Location 3:116755572-116755594
Sequence CTACCCAGTGAGATTGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960364584_960364585 -2 Left 960364584 3:116755551-116755573 CCTGAGAAGAAAATGATTATTCT 0: 1
1: 0
2: 2
3: 38
4: 488
Right 960364585 3:116755572-116755594 CTACCCAGTGAGATTGAAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960364585 Original CRISPR CTACCCAGTGAGATTGAAAG AGG Intronic
906349258 1:45043557-45043579 ATACTCAGAGAGATTGCAAGTGG - Intronic
909562663 1:77023652-77023674 CTTCACAGTTAGATTGAGAGTGG + Intronic
910447647 1:87315069-87315091 CTAGCCAGTGAGACATAAAGGGG + Intergenic
910758233 1:90712714-90712736 CCACCCAGGGAGAATGAAGGAGG - Intronic
913470685 1:119182566-119182588 TTCCCCAGGGAAATTGAAAGTGG + Intergenic
916833688 1:168519853-168519875 CTACCGAGTTAGATGGAGAGAGG - Intergenic
917072450 1:171167161-171167183 CAGCCCTGTGAGATAGAAAGAGG + Intergenic
917171839 1:172185198-172185220 ATCGGCAGTGAGATTGAAAGAGG + Intronic
919476963 1:198041076-198041098 CTAGCAAGTGAGGCTGAAAGAGG + Intergenic
920199316 1:204249776-204249798 CTGCCCAGTGAGACTGGGAGAGG - Intronic
923851300 1:237798194-237798216 CTACAGACTTAGATTGAAAGGGG + Intronic
924495570 1:244585420-244585442 CTACCCACTGAAATAGAATGAGG + Intronic
1063757031 10:9023566-9023588 CTACACAGTGAGATAAAATGAGG + Intergenic
1064587485 10:16852853-16852875 TTACACAGTGTGATAGAAAGAGG + Intronic
1069245254 10:66196702-66196724 CAACCTAGTCAGATTTAAAGAGG - Intronic
1072086687 10:92086579-92086601 TGACCCTGTGAGATTGTAAGTGG - Intronic
1073313215 10:102559217-102559239 CTAGCCAATGAGATGCAAAGGGG - Intronic
1074035830 10:109737542-109737564 GTACCCAGTGATATTTTAAGGGG + Intergenic
1074395571 10:113095339-113095361 CTACCCAGTGAGCATGAACTGGG - Intronic
1074501358 10:114027925-114027947 CAACCCTGTGAGGTTGCAAGGGG + Intergenic
1074918825 10:117986215-117986237 CTATACAGTGAGATTGATAATGG - Intergenic
1076198944 10:128542526-128542548 ATTCCAAGTGAGATGGAAAGGGG + Intergenic
1084876079 11:72135034-72135056 CTACCCAGTGGAATTTAATGTGG - Intronic
1084880944 11:72171513-72171535 CTACCCAGTGGAATTTAATGTGG - Intergenic
1087663695 11:101017341-101017363 CTACCCAAAGAGAAAGAAAGTGG - Intergenic
1088401930 11:109430781-109430803 CCACCCAGAGAGATTGAAGGAGG - Intergenic
1090142653 11:124281199-124281221 CTAGCCAGAGAGAATGAAATTGG + Intergenic
1090614876 11:128505741-128505763 CTACCCAGGCAGATGGAGAGTGG - Intronic
1090998202 11:131885960-131885982 CCACCCAGGGAGAAAGAAAGTGG + Intronic
1095906751 12:47385991-47386013 CTACCCAGTGGCACTGAAAGAGG - Intergenic
1099347901 12:81525536-81525558 CCACCCTGTGAGCTTGGAAGAGG + Intronic
1100021325 12:90072875-90072897 CTACATAGAGAGAATGAAAGAGG + Intergenic
1104194648 12:126522797-126522819 ATATCCAGTGAAATTGAAATCGG - Intergenic
1108172816 13:47760847-47760869 GTAACCAGTGAGCTTGGAAGAGG - Intergenic
1110809606 13:79797296-79797318 CTACCCAGTGGGAACCAAAGAGG - Intergenic
1111571481 13:90092982-90093004 GTACCCACTCAGATTGAAGGTGG + Intergenic
1112143395 13:96671342-96671364 CTTCCCAGTGTGATTGAGAGTGG + Intronic
1113258587 13:108534566-108534588 CTACCCAGGAAGGGTGAAAGTGG + Intergenic
1114840157 14:26253635-26253657 ATAGCAAGTGACATTGAAAGAGG - Intergenic
1120846346 14:89129392-89129414 CTACTCAGGATGATTGAAAGAGG - Intronic
1123755512 15:23394800-23394822 ACACCCAGTTAGATTGAATGTGG + Intergenic
1124725002 15:32148733-32148755 CTAAGCAGTGAGGCTGAAAGAGG - Intronic
1126098406 15:45105269-45105291 CTACCCAGTTAGACTGAACCAGG - Intronic
1129673405 15:77619573-77619595 CTACTCAGGGAGATTGAAGTGGG + Intronic
1130165867 15:81457431-81457453 CAACCTACTGAGATTGAATGAGG - Intergenic
1134556342 16:15168799-15168821 GTACCCAGAGAGACTGAAATAGG + Intergenic
1134916924 16:18080505-18080527 GTACCCAGAGAGACTGAAATAGG + Intergenic
1137562831 16:49513930-49513952 CTACCCAGTGAGATCAAGATGGG - Intronic
1142510181 17:387801-387823 CTACTCAATGACATTCAAAGTGG + Intergenic
1144010274 17:11141597-11141619 CTTCCCAGTGTGATTGTATGTGG - Intergenic
1145885705 17:28381180-28381202 CTGCCCAGTGAAAGTGGAAGGGG - Intronic
1151122858 17:71811947-71811969 CTACCCCCTGAGATTGAACCAGG + Intergenic
1153421177 18:4907033-4907055 ACACACAGTGAGCTTGAAAGAGG - Intergenic
1155101430 18:22614157-22614179 CTACCCAAGGAGATTGAAGGGGG - Intergenic
1167498892 19:49834764-49834786 CTGCCCACTGAGAGGGAAAGCGG - Intronic
931024955 2:58101688-58101710 CTACCCAGTGAGTCAGACAGAGG - Intronic
931102265 2:59015459-59015481 GGACCCAGTGACACTGAAAGAGG - Intergenic
932755314 2:74404073-74404095 ATAACCAGTGAGCTTGAAAGAGG - Intergenic
933684313 2:85131349-85131371 CTACTCAGTGAAACTGACAGTGG + Intergenic
935420686 2:102865873-102865895 CTTCCCAGGGAAATTCAAAGGGG + Intergenic
935834599 2:107036979-107037001 CTACCCAGTGAGGAGGAATGGGG - Intergenic
938930382 2:136081696-136081718 CTAGCCAGTGTGATTTCAAGGGG - Intergenic
941204337 2:162552847-162552869 TTAACCAGTGAGTTTGGAAGAGG + Intronic
942585272 2:177467962-177467984 CTACTAAGTGGGATTGAAGGTGG + Intronic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
946822002 2:223640102-223640124 CAACCCAGGGAGACTGAAGGAGG + Intergenic
948302336 2:236917005-236917027 CTGCTTAGTGACATTGAAAGAGG - Intergenic
1172786917 20:37474553-37474575 CCCCCCAGGGAGATTGAAAAGGG - Intergenic
1173705116 20:45104409-45104431 CAACCCTGTGAATTTGAAAGTGG + Intergenic
1178669744 21:34580129-34580151 ATTCCCAGTGAGAATGGAAGAGG + Intronic
1179140001 21:38717015-38717037 TTTCCCAGTGAGATTGAATCTGG + Intergenic
1179148292 21:38788188-38788210 CTGCCCAGTGAGATGGATGGGGG + Intergenic
949277271 3:2299108-2299130 ATATCCAGTGAAATTGAAAATGG + Intronic
949408898 3:3742633-3742655 TTACCAAGGGAGATTAAAAGGGG + Intronic
949797028 3:7862649-7862671 CTACGCAGTGAGAGAGAAAAAGG + Intergenic
951531880 3:23705606-23705628 ACAACCAGTGAGCTTGAAAGAGG - Intergenic
955052209 3:55423791-55423813 CTGGCCAGTGAGAATGAAAGGGG - Intergenic
958458597 3:94365256-94365278 ATAACCAGTGAGCTTGAAAGAGG + Intergenic
960364585 3:116755572-116755594 CTACCCAGTGAGATTGAAAGAGG + Intronic
960818298 3:121697404-121697426 CCACTCAGTGAGACTGAGAGGGG - Exonic
961206627 3:125087619-125087641 CTCCTCACTGATATTGAAAGGGG + Intronic
962381581 3:134902365-134902387 CCACCCAGTGAGATGGGAAGTGG + Intronic
962891493 3:139676948-139676970 CTACCCATTGAGAATGGAAATGG - Intronic
964432891 3:156624255-156624277 CTGGCCATTGAGATTGATAGGGG + Intergenic
964942847 3:162181970-162181992 CTAACTAGTGAGCTTGCAAGTGG + Intergenic
966093281 3:176166527-176166549 CTTCCCAGAGAGAGTGGAAGTGG + Intergenic
967642340 3:191880388-191880410 CTACCAAGTCAAATTGCAAGGGG + Intergenic
967943446 3:194783986-194784008 CTAGCCAATGAGATGGAAAGGGG + Intergenic
973934434 4:55828634-55828656 TTACCCAGTGATAGTGATAGTGG - Intergenic
974227775 4:59069259-59069281 TTTTCCAGTGAGATTGAAAAGGG + Intergenic
976835345 4:89366343-89366365 GTACCCAGTGAAATAGCAAGAGG + Intergenic
981337206 4:143581166-143581188 CTACCCAGTGAGGATAACAGTGG - Intronic
982576173 4:157112739-157112761 ATACCCAGTGACTTTGATAGGGG - Intronic
984759926 4:183355060-183355082 ATTCCCAGTGGGAGTGAAAGGGG - Intergenic
984801097 4:183717895-183717917 GTACCCAGTGACATGGCAAGTGG + Intergenic
985822934 5:2172654-2172676 CTGCCCAGGCAGATGGAAAGGGG - Intergenic
989556573 5:42803229-42803251 ATACCCAGTTATATTGAAAAAGG - Intronic
993486431 5:88492632-88492654 TTACACAGTGAGATTGTAAAAGG + Intergenic
995821765 5:116242623-116242645 TGACCCAGTGGGAATGAAAGGGG + Intronic
996886462 5:128360947-128360969 CCACACAGTGAGATTTAAACAGG + Intronic
996956417 5:129188123-129188145 CTACCCCGTGACAGTGACAGAGG + Intergenic
1000016984 5:157286840-157286862 CTGCCCAGTGTGATTGAGAGTGG + Intronic
1001816837 5:174676367-174676389 CTACCCATTGAGCTCGGAAGAGG - Intergenic
1003487604 6:6593126-6593148 CTACCCAGTGAAATTGATTTTGG - Intronic
1007039242 6:38706276-38706298 CTACACAGTAAAATTGCAAGTGG + Intergenic
1008404926 6:51108228-51108250 CTACAAAGTCACATTGAAAGGGG + Intergenic
1009882837 6:69590974-69590996 CTTTACAATGAGATTGAAAGTGG - Intergenic
1018604322 6:165580954-165580976 CTACCCAGTGAGAAAGAAGATGG + Intronic
1020451199 7:8322295-8322317 CCACCCAGTGAGCTTGGCAGAGG + Intergenic
1020737206 7:11965628-11965650 CTACCCAGTGTTTCTGAAAGTGG - Intergenic
1024413113 7:49070429-49070451 CTAACCAGTGAGACTGAACTGGG + Intergenic
1025639061 7:63350256-63350278 CAGCCCACTGACATTGAAAGGGG + Intergenic
1025643638 7:63397836-63397858 CAGCCCACTGACATTGAAAGGGG - Intergenic
1026432942 7:70366397-70366419 CTCCCCAGAGAGAGAGAAAGTGG + Intronic
1026620432 7:71945397-71945419 CAACCCAATGAGAATGAAATAGG + Intronic
1033668178 7:143463551-143463573 ATAATCAGTGAGATTGGAAGAGG - Intergenic
1034018353 7:147611364-147611386 CTACCCAGTGTGAGTGAAAAAGG + Intronic
1034477902 7:151298310-151298332 CAACCCAGTGAGATTCATGGCGG + Intergenic
1034959896 7:155358638-155358660 CAAGCCAGTGACCTTGAAAGAGG - Exonic
1037875537 8:22545436-22545458 CTAGCCAGCGAGAGTGAATGGGG + Intronic
1038906206 8:31906193-31906215 CCACACAGTGAGCTTGGAAGTGG - Intronic
1040428087 8:47309589-47309611 TGACCCAGTGATACTGAAAGGGG - Intronic
1042682691 8:71404070-71404092 CTACGAAGTCAGATTGAAAATGG + Exonic
1043029837 8:75120554-75120576 CAACCCTGTGAGCTTCAAAGTGG - Intergenic
1043277517 8:78418360-78418382 CTACACAGTGTTATTGAAATAGG + Intergenic
1045936814 8:107689523-107689545 ATACCCAAAGAAATTGAAAGCGG - Intergenic
1049956589 9:698709-698731 CTACCCAATTAGATGGTAAGTGG - Intronic
1050039541 9:1474807-1474829 CTACTCAGTGAGCTTGAGATGGG + Intergenic
1050937438 9:11415559-11415581 CTTCACAGTGAAAATGAAAGTGG + Intergenic
1053053865 9:34982133-34982155 CTACCCAGTGCTATAGAAACTGG - Exonic
1053192591 9:36085424-36085446 TTACACTGTGATATTGAAAGAGG + Intronic
1055121452 9:72665094-72665116 TTACCTACTGACATTGAAAGGGG - Intronic
1057365349 9:94415434-94415456 CTACCCAGGAATATTTAAAGAGG - Intronic
1057657971 9:96972641-96972663 CTACCCAGGAATATTTAAAGAGG + Intronic
1059970700 9:119665347-119665369 GTAGACAGTGAGATTGAAAAGGG - Intergenic
1060077853 9:120610024-120610046 CTACCCACTAGGATTGTAAGTGG - Intronic
1060553324 9:124495826-124495848 CTGCCCAGTGAGGCTGATAGGGG + Intronic
1062199075 9:135291465-135291487 GTACCCAGAGAGAGAGAAAGAGG + Intergenic
1187790708 X:22947038-22947060 GCACACAGTGAGATTGGAAGGGG + Intergenic
1188777283 X:34235672-34235694 CTACCCAGTGAGAATGATATAGG + Intergenic
1192547021 X:72022647-72022669 CTCCCCAGTGAGATGGTACGGGG - Intergenic
1193124543 X:77857294-77857316 CCTCCCAGTAAGATTCAAAGGGG + Intronic
1193944190 X:87711774-87711796 CAACCCACTGAGATTGAATCAGG + Intergenic
1194118268 X:89930059-89930081 CTACCCTGTGTGTTTGAATGTGG + Intergenic
1194953710 X:100155234-100155256 CAACCTACTGAGATTGAAACAGG - Intergenic
1200126885 X:153819429-153819451 GTTGCCAGTGAGAGTGAAAGGGG - Intronic
1200225995 X:154418106-154418128 CTATCCATTGAGCTTGAAACTGG - Intronic
1200471147 Y:3587624-3587646 CTACCCTGTGTGTTTGAATGTGG + Intergenic