ID: 960364700

View in Genome Browser
Species Human (GRCh38)
Location 3:116757112-116757134
Sequence GCTGGTGGTAAGGTTAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960364700 Original CRISPR GCTGGTGGTAAGGTTAAAGC TGG (reversed) Intronic
901285913 1:8078696-8078718 GGTGGTGGGAAGGTTGGAGCAGG + Intergenic
902801360 1:18832121-18832143 GCTGCTGGGAAGCTCAAAGCAGG - Intergenic
903992806 1:27286115-27286137 GCTGCTCGGAAGGTTGAAGCAGG - Intronic
904340063 1:29828707-29828729 GCTGGTGGGAAGGGTAAGGAGGG - Intergenic
904910427 1:33930554-33930576 GCAGGTGGTAGGGAGAAAGCTGG - Intronic
910702696 1:90093269-90093291 GATTGTGGTAAGGTCTAAGCAGG + Intergenic
914693528 1:150053930-150053952 GCTGGTGGCAAGGTGAAAAAGGG + Intergenic
915476168 1:156154010-156154032 GCTGGGGGAGAGGTTAGAGCAGG + Intronic
916316180 1:163450702-163450724 GCTGGGGCCAAGGTTAAAGTGGG - Intergenic
916433771 1:164758071-164758093 GCTGTGGGTAAGGATAAAACTGG - Intronic
919056266 1:192573207-192573229 GCTGGAGGCAAGGTGAAAGGTGG + Intergenic
922895145 1:229094156-229094178 GCTTGTGGTAAGGTAAAGGTGGG - Intergenic
1062956888 10:1546413-1546435 GCAGGTGGTAATTTTAGAGCTGG - Intronic
1063962180 10:11315735-11315757 GCTGCTGGAAAAGTCAAAGCTGG - Intronic
1065299356 10:24307368-24307390 GCTGGTGGGAAGCTTAACACAGG - Intronic
1065411430 10:25433608-25433630 GGTGGTGGTAAGGGTAAATAAGG + Intronic
1070933074 10:80274336-80274358 CCTGGTTGTCAGGTTAAAGGAGG - Intronic
1071698910 10:87908138-87908160 GCTGGTGGTAATGTAAAATTGGG - Intronic
1074536389 10:114331178-114331200 ACTACTGGTAAGGTTCAAGCAGG + Intronic
1079140061 11:17802676-17802698 GCTGGTGCAAAGGCTAAAGCTGG - Intronic
1083399671 11:62414946-62414968 GCTGGTGGTTGGGGTGAAGCGGG - Intronic
1084072168 11:66743834-66743856 GCTGGTTGTAAGGTAAAAGACGG + Intergenic
1084631234 11:70352539-70352561 GGTGGTTGTGAGGTTAAACCAGG + Intronic
1085022352 11:73217754-73217776 GCTGCTGATAAGATTAAGGCAGG + Intergenic
1090410833 11:126508534-126508556 GATGGTGGAAGGGTTCAAGCAGG + Intronic
1094011145 12:25811181-25811203 ACTGGTGGCAATGTTAAAGAGGG - Intergenic
1094534245 12:31306943-31306965 GAAGGTGGTAAGGTTAAAGCAGG - Intronic
1095589189 12:43884802-43884824 TCTGGTGGTAAGTTGAATGCAGG - Intronic
1099604810 12:84790168-84790190 ACTGGTCTTAAGGTTATAGCTGG + Intergenic
1101733342 12:107444396-107444418 GCTGGTCATAGGGTTAAAACAGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102374205 12:112408568-112408590 GCTGGTGGCAAGGTGAAAAAGGG - Exonic
1103340416 12:120218154-120218176 GCTGCTGGGGAGGCTAAAGCAGG - Intronic
1104489647 12:129182939-129182961 GGTGGTGGTTAGGTTACAACAGG + Intronic
1108712787 13:53050284-53050306 GTTGGTGGTCAGGTTAACTCTGG - Exonic
1109001502 13:56811325-56811347 GCAGGTGGTAAGGCAAAACCAGG - Intergenic
1109195480 13:59373542-59373564 GCTGTTGTTAAGATTAAAGGAGG - Intergenic
1111734093 13:92115392-92115414 GCTACTGGGAAGGTTGAAGCAGG + Intronic
1112527383 13:100164432-100164454 GCTGGTCTTAGGGTTACAGCAGG + Intronic
1113859767 13:113473700-113473722 GAGGGTGGTAACGTTACAGCTGG + Intronic
1120055523 14:79919642-79919664 GCTGGTGGAAAAGCTAAAGGAGG + Intergenic
1122703548 14:103606189-103606211 GCTGCTGGGGAGGCTAAAGCAGG + Intronic
1126427743 15:48547495-48547517 TCTGGTGGAAAACTTAAAGCAGG + Intronic
1126896006 15:53257937-53257959 GATGCTGGTACTGTTAAAGCTGG + Intergenic
1127384014 15:58452816-58452838 GCTGGTAGTGAGGGTACAGCTGG + Intronic
1134408130 16:13980830-13980852 GCTGGGGCAAAGGTTAAAACTGG + Intergenic
1134616857 16:15658183-15658205 GCTGGAGGTAAGCCTGAAGCCGG - Intronic
1145897374 17:28467249-28467271 GGAGGTGGTAAGATTAATGCTGG - Intronic
1147166714 17:38597283-38597305 GCTGGTGGTAAGAAGGAAGCTGG - Intronic
1147377133 17:40029155-40029177 GCAGGTGGTAAGGTTGGAGTGGG + Intronic
1151268555 17:72975798-72975820 CCTGGTAGTAAGGCTACAGCAGG + Intronic
1153570161 18:6462922-6462944 GCTGGTGGCAAGGTGAAAAAGGG - Intergenic
1154037093 18:10813849-10813871 GCTGGTGGGAATGTAAAATCGGG - Intronic
1158016575 18:52791057-52791079 GCTGGTGGTGTGGTTGGAGCTGG + Intronic
1160333829 18:78018974-78018996 ACTGGTGGTAGGGTGAGAGCTGG + Intergenic
1161028178 19:2046204-2046226 GCTGGTGATCAGGTTGATGCAGG + Exonic
1161485127 19:4531440-4531462 GCTGGTGATCAGATTAAAGAAGG + Intronic
1168301169 19:55406004-55406026 GCTGGTGGAAGGTTTAAAGCAGG - Intronic
925947675 2:8880650-8880672 GCTAGTGGTAAGGCAGAAGCAGG + Intronic
928518097 2:32063137-32063159 GCTGGTTGGAAGGCTAAGGCCGG - Intergenic
932094928 2:68839174-68839196 GCAGGAGGGAAGTTTAAAGCTGG - Intergenic
937894890 2:126971298-126971320 GCTCTAGGGAAGGTTAAAGCCGG + Intergenic
937898409 2:126996483-126996505 ACTGGTGGTCATGTTAGAGCAGG - Intergenic
940343997 2:152610881-152610903 GCTGGTGGTAATGTAAAAAAGGG - Intronic
940688015 2:156878578-156878600 GCTACTGGAAAGGTTAAAGCAGG + Intergenic
941064196 2:160882408-160882430 GCTACTTGGAAGGTTAAAGCGGG + Intergenic
942560023 2:177210322-177210344 GCTGCTGGGAAGGCTGAAGCAGG - Intergenic
942679811 2:178465422-178465444 CATGCTGGTAAGGTTAAAGTTGG + Exonic
946198654 2:218056739-218056761 ACTGGTCTTAAGGTTACAGCAGG - Intronic
947830226 2:233134323-233134345 GCTGGGGGTAAGGTCACTGCAGG + Intronic
948910513 2:241000089-241000111 GCTGGTGGTGGGGTTGAAGGAGG - Intronic
1168919468 20:1518980-1519002 GATGGTGCTTTGGTTAAAGCAGG - Intergenic
1169752296 20:9006840-9006862 GGTTGTGGGAAGGTTAAAGCAGG - Intergenic
1169864524 20:10185669-10185691 GCTTGTGGTAAGGTGGAAGGAGG + Intergenic
1170535236 20:17334607-17334629 ACTGGTGGTAAAGTTAAGGCTGG + Intronic
1170892638 20:20389098-20389120 CCTGGTGGTATGGCTGAAGCCGG - Intergenic
1171937566 20:31289762-31289784 GCTGGTTGTTGGGTTGAAGCTGG - Intergenic
1171963407 20:31512125-31512147 GCTGGTAGTAAGCCTAAAGTGGG + Intergenic
1173218303 20:41108940-41108962 TCTGTTTGTAAGGTTAAGGCTGG - Intronic
1174691670 20:52512402-52512424 GCCGGTGGGAAGTTTAAACCAGG + Intergenic
1175263691 20:57690114-57690136 GCAGGTGGGAAGGTTAGATCTGG - Intronic
1177124253 21:17176216-17176238 GCTATTGGGAAGGCTAAAGCAGG + Intergenic
1178977794 21:37234446-37234468 GCTGGTATTGAGCTTAAAGCAGG + Intronic
1182101993 22:27663919-27663941 GCTGGTGGAAAGGTGAAAGGTGG + Intergenic
1184449216 22:44573080-44573102 GCTGTGGGTGAGCTTAAAGCAGG - Intergenic
1184505846 22:44901645-44901667 GCTGGTGGCAAGGTGAAAAGGGG + Intronic
1184792690 22:46709552-46709574 GCTGGTGCTAAGGTTAGAAAGGG - Intronic
1185258408 22:49849014-49849036 GAGGGTGGTAAGGTGAAACCTGG + Intergenic
950094804 3:10322539-10322561 GGTGGTGGTTAGGTTAGAGCAGG + Intergenic
950396348 3:12736988-12737010 GCTGCTTGTGAGGCTAAAGCAGG - Intronic
953713335 3:45293837-45293859 GCTGATGGGAAGGTTAAACGTGG - Intergenic
956670165 3:71681580-71681602 GCTAGTGGGCAGGTTAAGGCTGG + Exonic
960364700 3:116757112-116757134 GCTGGTGGTAAGGTTAAAGCTGG - Intronic
961112445 3:124296595-124296617 GCTGGTGGGAGGTTTTAAGCTGG - Intronic
962146784 3:132848038-132848060 GCTGGTGGGAAGATCAAAGGTGG - Intergenic
965080029 3:164022718-164022740 GCTGGGGGAAAGGTTTAAGGAGG + Intergenic
966076439 3:175940970-175940992 GCTGGTGGCTGGGGTAAAGCTGG - Intergenic
966128978 3:176614781-176614803 GCTGGTGGGAGGATTATAGCAGG - Intergenic
970730638 4:19099767-19099789 ACTGGAGGTAAAGTTAACGCTGG - Intergenic
974458338 4:62156999-62157021 GCTGGTGGTAGAGTTAATGCTGG + Intergenic
974709625 4:65573525-65573547 GCTGGTGGCAAGGTGAAAAAGGG + Intronic
974976977 4:68904280-68904302 GGTGGTGGTAGAGTTAAAACTGG - Intergenic
976593239 4:86870257-86870279 GCTGGTGGCAAGGTAAAAAGGGG + Intergenic
979425168 4:120554833-120554855 GGTGGTGGTCAGGTTAAAGGGGG + Intergenic
980233032 4:130068275-130068297 ACTGGTCTTAAGGTTACAGCAGG - Intergenic
983567251 4:169166337-169166359 GCTGGTGGTAAGGTGAAAACGGG + Intronic
984823094 4:183901061-183901083 GCTGGAGGAAAGGTGAAAGGAGG - Intronic
986619259 5:9653905-9653927 TCTGCAGGTAAGGTTACAGCTGG + Intronic
991557404 5:67911039-67911061 GCTGCTGGAAAGGTTAGAGGAGG - Intergenic
992262892 5:74988695-74988717 GCTGGTGGAAATGTAAAATCAGG - Intergenic
992494538 5:77280009-77280031 GCTGGGCGTCAGGATAAAGCTGG - Intronic
993133019 5:83923157-83923179 GCTGATGATATGATTAAAGCAGG - Intergenic
995951197 5:117716040-117716062 GCTGGTGGGAAGGTAGAGGCAGG + Intergenic
997752274 5:136357688-136357710 GGTGGTGGTATGGCTGAAGCAGG + Intronic
1001034656 5:168289102-168289124 GCTTGTGGTTAGGGCAAAGCAGG - Intergenic
1004981221 6:21027084-21027106 GCTGGTGGTAGGGTTATGGCTGG - Intronic
1008258484 6:49334642-49334664 GTTTGTGATAAGGTTAAACCAGG - Intergenic
1008807811 6:55453288-55453310 GCTGCTGGTAAGGCTGAGGCAGG - Intronic
1009637726 6:66286639-66286661 GCTGATTGTAAGATTAAGGCAGG - Intergenic
1009948940 6:70372797-70372819 GCTGGTGGGAATGTAAAAGGTGG - Intergenic
1013899956 6:115143248-115143270 GATTGTGGTAAGGTTTAACCAGG - Intergenic
1016474840 6:144415901-144415923 GCTGGTGGGTAGGTTAGAGGTGG + Intronic
1017661459 6:156678212-156678234 GCTGGAAGTTAAGTTAAAGCTGG - Intergenic
1017983008 6:159419175-159419197 GGTTGTGGTAAGGATTAAGCTGG - Intergenic
1023107506 7:36776885-36776907 GCTGTTGGTAAGGGCAGAGCTGG + Intergenic
1024769753 7:52707025-52707047 GCTGCTGGTGAGGTTAAAGTGGG - Intergenic
1025735367 7:64142313-64142335 GCTGGTGGCAAGGTGCAAGAGGG - Intronic
1026792602 7:73344378-73344400 GCTGATGGTAAGATAAATGCTGG - Intronic
1029467057 7:100732484-100732506 GCTGGTTGTGAGGTTGAGGCGGG - Intergenic
1029680650 7:102106788-102106810 GCTGGTGGTAGGGCTGAAGAAGG - Intronic
1031606880 7:123779540-123779562 GGTGGTGGTAAGGGTATAGATGG + Intergenic
1033020762 7:137722053-137722075 GCTGGTGGCAAGGTGAAAAAGGG + Intronic
1035332555 7:158105777-158105799 GATGGAGATAAGGATAAAGCAGG - Intronic
1036089733 8:5652647-5652669 GGTGGAGGGAAGGTTAAAGAGGG + Intergenic
1038160136 8:25029044-25029066 CCTGATGGTAAGGTTGAAGTGGG + Intergenic
1040499682 8:47995713-47995735 GCTGGGGGAAAGGTTTAAGGAGG + Intergenic
1043872083 8:85444422-85444444 GGTGGTGGTAAGGGCAAAGGTGG + Intronic
1048579927 8:135722505-135722527 GTTGGGGGTAAGGGCAAAGCAGG + Intergenic
1050214312 9:3305391-3305413 GCTAGTAGTAAGGTTAAAATAGG + Intronic
1054951731 9:70859221-70859243 GCTGGTGATCAGGTTAAACAAGG - Intronic
1055768449 9:79690721-79690743 CCTTGTGGGAAGGTTAAAGTGGG - Intronic
1057269164 9:93637879-93637901 GCTGGTGGGAAGGTAAAACGGGG - Intronic
1192374138 X:70541955-70541977 GCTAGTGGTAATGAAAAAGCAGG - Intronic
1192970433 X:76222555-76222577 GCTTGTGTTAATGTTAATGCTGG + Intergenic
1194278186 X:91913342-91913364 GCTTGTGGCAAGGTCAGAGCAGG + Intronic
1194948431 X:100095715-100095737 GCTGCTTGGAAGGCTAAAGCAGG + Intergenic
1196752440 X:119130120-119130142 GCTGGTGGACAAGTTTAAGCGGG - Intronic
1201729328 Y:17188093-17188115 GCTGTGGGAAAGCTTAAAGCTGG + Intergenic