ID: 960369627

View in Genome Browser
Species Human (GRCh38)
Location 3:116817791-116817813
Sequence GCCCTACATTTCCCTGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960369627_960369629 8 Left 960369627 3:116817791-116817813 CCAGGTGCAGGGAAATGTAGGGC 0: 1
1: 1
2: 1
3: 13
4: 128
Right 960369629 3:116817822-116817844 GTAGACTTAAATACTGCCCTTGG 0: 1
1: 0
2: 0
3: 1
4: 81
960369627_960369630 18 Left 960369627 3:116817791-116817813 CCAGGTGCAGGGAAATGTAGGGC 0: 1
1: 1
2: 1
3: 13
4: 128
Right 960369630 3:116817832-116817854 ATACTGCCCTTGGCATTTTACGG 0: 1
1: 0
2: 0
3: 14
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960369627 Original CRISPR GCCCTACATTTCCCTGCACC TGG (reversed) Intronic
900529334 1:3145043-3145065 ACCCTAGATGTCCCTGCACTTGG + Intronic
900602496 1:3509168-3509190 GCCCCACATTGCCGTGCTCCAGG - Exonic
904318529 1:29681576-29681598 ACCCCACCTGTCCCTGCACCTGG - Intergenic
904439588 1:30521714-30521736 GCCCTACAGTTCCCTCTCCCAGG + Intergenic
905460448 1:38119305-38119327 GCCCCACATTTCCCTAGCCCAGG + Intergenic
915375773 1:155393905-155393927 TCCCTGGATTTCCCAGCACCTGG - Intronic
917995401 1:180433788-180433810 GCCCTCCTTTTACCTGCCCCAGG + Intronic
1063514239 10:6678506-6678528 TCCCTTCATTTCCATGCAACAGG - Intergenic
1067272815 10:44806696-44806718 GCCTTACACTTCCCTACACATGG + Intergenic
1067768701 10:49108467-49108489 GCCCTACCCTGCCCTGCTCCAGG - Intronic
1069220492 10:65877258-65877280 CCCCTCCATTTCACTGCACCAGG - Intergenic
1069921358 10:71817747-71817769 ACCCTTCATCTACCTGCACCCGG + Intronic
1072851091 10:98892901-98892923 GCCCTCCTGTTCCCTGCTCCAGG - Intronic
1073133397 10:101205392-101205414 GCCCTACCTTGCCCAGCTCCCGG + Intergenic
1073254291 10:102141140-102141162 GCCCTGCCTTTCCCTGCAGGTGG + Exonic
1073286160 10:102390025-102390047 GCCCTACTGTTCCCTCCACCTGG + Intergenic
1074464232 10:113667609-113667631 GCCCTCCACTTCCCTGCCTCTGG - Intergenic
1074919530 10:117993259-117993281 GCCCTCTATTTCCCTGAACTGGG - Intergenic
1075464850 10:122643495-122643517 GCCCTACATTGTGCTGCACCTGG + Exonic
1077130217 11:968317-968339 GGCCTAAGTTTCCCAGCACCCGG + Intronic
1079394421 11:20049674-20049696 GCCCTGGATTTCTCTGCAGCAGG + Intronic
1079923832 11:26467432-26467454 GCCCTACATTTCCCAAACCCTGG + Intronic
1085476725 11:76793849-76793871 GTCCCACTTTTCCCTGCCCCTGG + Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1091003087 11:131927267-131927289 GTCTGACATTTCCCTGCACCTGG + Intronic
1092080584 12:5712859-5712881 GCCGAACATTTCCCAGCTCCTGG - Intronic
1096008348 12:48190541-48190563 GCCCCTCATTTTCCTGCATCTGG + Intergenic
1098784224 12:74729402-74729424 ACCCAACCTTTCCCAGCACCGGG + Intergenic
1101828461 12:108239239-108239261 CACCTACGTTTCCCAGCACCTGG + Intronic
1101836472 12:108299163-108299185 GCCCTGCATATGCCTGCACCAGG + Intronic
1103725675 12:122996370-122996392 GCCCTGCCTGTTCCTGCACCTGG - Intronic
1104870418 12:131991293-131991315 GTCCTTCCTTTCCCTGCACGTGG + Intronic
1107916345 13:45155840-45155862 GCCTTACATTTCCCTGCCTTGGG + Intronic
1110628233 13:77675991-77676013 ACCCTACTTCTCCCTGGACCTGG - Intergenic
1117851324 14:59973336-59973358 GCCTTACAATGCCCTGCACGTGG + Intronic
1118767437 14:68919334-68919356 TCTCTACACTTCCCTGCCCCAGG + Intronic
1121101488 14:91253287-91253309 GCCCTTCATTTCCCAGAGCCCGG - Intronic
1122480192 14:102042206-102042228 ACACTAAGTTTCCCTGCACCAGG + Exonic
1123017302 14:105381562-105381584 GCCCTGCACTGGCCTGCACCTGG + Intronic
1128103583 15:65026638-65026660 GCCCTTCAGTTACCTGAACCTGG + Intronic
1128128802 15:65211839-65211861 GCCCCACATTCCCCTGGCCCTGG + Intergenic
1129651421 15:77493397-77493419 CCCCTACATTTCCCTGCTCCAGG - Intergenic
1129687986 15:77697150-77697172 CCCCTACACAGCCCTGCACCAGG - Intronic
1130166203 15:81461525-81461547 TCTCTCCATTTCCCTGCATCAGG + Intergenic
1131686463 15:94773277-94773299 GCCCTACCTAGCCCTGCACCTGG + Intergenic
1132643903 16:990079-990101 GCCCTACACTGCTCTGCTCCAGG - Intergenic
1136275575 16:29177491-29177513 GCCATGCATCTCCCTGCAGCGGG + Intergenic
1138204479 16:55114761-55114783 GCACACCATTTCCCTCCACCAGG - Intergenic
1139467919 16:67164098-67164120 GCCCTCCCTCTCCCTGCGCCGGG - Exonic
1139656904 16:68393458-68393480 GCCATACAGTTACCTGAACCAGG - Intronic
1143756533 17:9071929-9071951 CCCCTACATTTCACAGCCCCTGG + Intronic
1147304772 17:39555654-39555676 TCCCTACATTTGCTTACACCTGG - Intronic
1148744554 17:49911140-49911162 GCTCCACATTTCCCTTCTCCGGG - Intergenic
1149588815 17:57812116-57812138 GCCCTGCCTTCCCCTGCCCCTGG + Intergenic
1151429488 17:74052818-74052840 GGGCTTCATTTCCATGCACCAGG + Intergenic
1152611443 17:81316708-81316730 GCCCTACATAAGTCTGCACCTGG - Intronic
1157292869 18:46422511-46422533 GGACTACATCTCCCTCCACCTGG + Intronic
1158990828 18:62866708-62866730 GCCCAAAATATCCCTCCACCTGG - Intronic
1159084615 18:63774573-63774595 AACCTACCTTTCCCTACACCTGG + Intronic
1162128259 19:8510917-8510939 GCCCGCCATGACCCTGCACCTGG - Exonic
1163488294 19:17602474-17602496 GCCCCACATTTCCATGAATCGGG - Exonic
1165110509 19:33499487-33499509 GCCCTACATGTCCCTGGGACTGG + Intronic
1166317202 19:41995923-41995945 TTCACACATTTCCCTGCACCAGG - Intronic
1166716271 19:44970169-44970191 GTCCTAGGTTTCCTTGCACCAGG + Intronic
1166743908 19:45130845-45130867 GCCCTAAATATTCCTGCTCCAGG + Intronic
1167473564 19:49688143-49688165 GCCCCACCTCTCCCTGCAGCGGG + Exonic
1167754846 19:51406023-51406045 GCCCTGCATCTCCCTGCGCAGGG + Intergenic
1168018767 19:53594223-53594245 GCCCTAAATCTCCCTGGACCAGG - Intergenic
1168455687 19:56506642-56506664 GCCCTACATGTCTCTTCATCTGG + Intergenic
1168520354 19:57045286-57045308 GCCTTAGAGATCCCTGCACCAGG + Intergenic
925274890 2:2641691-2641713 GCCCTCCATTTCCCAGTCCCGGG + Intergenic
927089617 2:19700632-19700654 GCCCTTCATTCCCCACCACCAGG + Intergenic
927362834 2:22256338-22256360 GCACTACATTTCCCAGCCTCTGG + Intergenic
927920099 2:26965620-26965642 GCCCTTCCTTTCCCTTCATCAGG - Intergenic
929997893 2:46840437-46840459 GCCCCACATCTTCCTGCTCCTGG + Intronic
935546530 2:104405697-104405719 GCTCTACATTTCCCTTTTCCTGG - Intergenic
936063920 2:109316348-109316370 GCTCTACATGCCCCTGCTCCTGG + Intronic
936242842 2:110802717-110802739 TCCCTACCTTTCCCAGCCCCTGG - Intronic
938066699 2:128285419-128285441 GCCCTGCCTTGCCCTGCACTGGG + Intronic
939435187 2:142167065-142167087 CCCCCACATTGCCCTGCCCCTGG - Intergenic
939732950 2:145808053-145808075 GCCCTACATGTCACTTCACTTGG + Intergenic
945322488 2:208441256-208441278 GCCCTATATGTCTCTTCACCTGG - Intronic
946161460 2:217838490-217838512 TCCCTCCATTTCCCTGCCTCTGG - Intronic
1172144161 20:32744432-32744454 CCCCCACATTTCCCTGCTCCAGG - Intergenic
1172276893 20:33684989-33685011 GCCCCACAGTTCCCAGCTCCAGG + Intronic
1172701115 20:36854275-36854297 GCCCCACCTTTCCCTGCATGAGG - Intronic
1173144793 20:40515250-40515272 CACCTGCTTTTCCCTGCACCTGG + Intergenic
1173923693 20:46764892-46764914 TCCCTTCATTTCCCTGCTCTTGG - Intergenic
1182016778 22:27046959-27046981 GCCCTACATTTCCATCATCCTGG - Intergenic
1184866269 22:47203363-47203385 TCCCTTCATTTCCCTGCTCATGG + Intergenic
1184892813 22:47389951-47389973 GACCTCCATCTTCCTGCACCGGG + Intergenic
950425078 3:12920821-12920843 GGACTACATTTCCCAGCTCCCGG + Intronic
952337817 3:32420356-32420378 TCCCTACATTTCCCCTCACCCGG - Intronic
953362803 3:42313567-42313589 GCCATGCATTTCCCTGTACAAGG - Intergenic
954196322 3:48999211-48999233 GCCCTCCAGGGCCCTGCACCTGG + Intronic
954855474 3:53640421-53640443 GGGCTACATTTCTCAGCACCTGG - Intronic
957925948 3:86811576-86811598 CCCCTACCTTTCCCAGCCCCTGG - Intergenic
960369627 3:116817791-116817813 GCCCTACATTTCCCTGCACCTGG - Intronic
966472899 3:180311677-180311699 GCTCTGCTTTTCCCTGCCCCTGG - Intergenic
967493610 3:190120263-190120285 GCCCTACAACTACCTGCAGCGGG - Exonic
967849126 3:194069396-194069418 GCCATACTGTTCCCTTCACCAGG + Intergenic
968816270 4:2823443-2823465 GCCCTAGGATTCCCTGCTCCAGG + Intronic
968975876 4:3821801-3821823 GCCCTGCCTTTCCCTGCCCCAGG - Intergenic
971105971 4:23524584-23524606 GCCTCAGATTTCCCAGCACCTGG - Intergenic
972661738 4:41122973-41122995 CCCCTGCAGTTCCCTCCACCTGG + Intronic
981384935 4:144118713-144118735 GCCCATCATTTCTCTGAACCAGG - Exonic
981617867 4:146661505-146661527 GCCCTACATTTCCCAGCACCTGG + Intergenic
984606365 4:181789870-181789892 GCCCTACACATCCCTTCACCTGG + Intergenic
985046442 4:185945797-185945819 GCCCTCCATTTCCGGGCACATGG - Intronic
987323533 5:16792497-16792519 TCCATCCATTTCCCTGCCCCAGG + Intronic
987339884 5:16930551-16930573 GGTCGAGATTTCCCTGCACCAGG + Intronic
997387785 5:133487229-133487251 CCCTTACATCTCCCTGCACTTGG + Intronic
1000394716 5:160761419-160761441 AGCCTACATTCCCCAGCACCAGG + Intronic
1000398992 5:160805638-160805660 GCCTCACATTTCACTGTACCTGG - Intronic
1002509684 5:179705915-179705937 AGACTACATTTCCCTGCACCCGG - Intronic
1003486390 6:6583646-6583668 TGCTTACATTTCCCAGCACCAGG - Intergenic
1004460166 6:15828066-15828088 GGCCTCCCTTTCCCTGCCCCAGG - Intergenic
1007937470 6:45746017-45746039 GACCCACTTCTCCCTGCACCAGG + Intergenic
1011903010 6:92324562-92324584 ACTCAACATTTCCCTTCACCAGG + Intergenic
1013178875 6:107701255-107701277 TCCCACCATTTCCCTGCAGCAGG - Intergenic
1028916856 7:96268801-96268823 GCCCTGCACTTCCATGCTCCAGG + Intronic
1034255766 7:149723927-149723949 ATCCTACATTACCCTGCCCCAGG + Intronic
1037753914 8:21699454-21699476 GTCCCACCTTTCCCAGCACCAGG - Intronic
1037846972 8:22292099-22292121 ACCCTGCATGTGCCTGCACCAGG - Intronic
1039781932 8:40794611-40794633 GCCCTGCGGTTTCCTGCACCAGG - Intronic
1041521957 8:58766994-58767016 GTGATACATTTCCCTGCATCTGG + Intergenic
1042618673 8:70678633-70678655 GCCATGAATTTCCCTGCAGCAGG - Intronic
1050598530 9:7227759-7227781 TCCCTACATTTCCCAGCCCCTGG + Intergenic
1051241367 9:15060142-15060164 TCCCTACATTTCCCTTCTCTGGG + Intergenic
1052032975 9:23649220-23649242 GCCCTGCTCATCCCTGCACCAGG - Intergenic
1057089500 9:92244359-92244381 GCTCTACCTTCCCCTGCACATGG + Intronic
1057820948 9:98330187-98330209 ACCCTACATTTTCCTGCTCAAGG + Intronic
1060478957 9:124006546-124006568 GCCCCTCATTTCCCTCCTCCGGG + Intronic
1062385353 9:136307168-136307190 GCGCGTCATTTCCCTCCACCTGG - Intergenic
1188511398 X:30940069-30940091 GCTCAACACTTCCCAGCACCTGG - Intronic
1190714906 X:53094789-53094811 GCATTACTTTGCCCTGCACCCGG + Intergenic
1190919953 X:54841591-54841613 GCCCTACAACTCCCAGCCCCTGG + Intergenic
1192152558 X:68721200-68721222 CAGCTACATTTGCCTGCACCAGG - Intronic
1193887567 X:87001886-87001908 CCCTTACATTTCCCAGCATCTGG - Intergenic
1194780826 X:98023486-98023508 GCCATTCATCTCCCTGCTCCTGG - Intergenic
1195590764 X:106622995-106623017 GCCCTTTATTTCCCTGATCCAGG + Intronic
1199141565 X:144319952-144319974 GCCCCATAATTCCCTGCATCTGG - Intergenic
1201757534 Y:17502508-17502530 TGCCTGCATTTCTCTGCACCAGG + Intergenic
1201844020 Y:18403474-18403496 TGCCTGCATTTCTCTGCACCAGG - Intergenic