ID: 960371478

View in Genome Browser
Species Human (GRCh38)
Location 3:116846324-116846346
Sequence CTGCTTGTTGATGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960371478 Original CRISPR CTGCTTGTTGATGTGGAGGA GGG Intronic
900312769 1:2042320-2042342 CTGGCAGCTGATGTGGAGGAAGG + Intergenic
901324396 1:8358212-8358234 CTGCTGGTGGAGGTGGAGGTGGG + Exonic
901379326 1:8862520-8862542 CTGTTTGTGGATGTGGAGCCAGG - Intronic
903212282 1:21824852-21824874 CTGCATGTTGGCGTGGAGGTGGG - Exonic
904755402 1:32766016-32766038 CTGCTTGTGGGTTGGGAGGATGG + Intronic
906442806 1:45864339-45864361 CTGCTCTTTTATGTGCAGGAGGG - Intronic
907240356 1:53077674-53077696 CAGCTTGTTGTTCTGGGGGATGG - Exonic
907634084 1:56115808-56115830 CTCCTTGTTTGTATGGAGGAGGG + Intergenic
909068666 1:70965664-70965686 CTGCTTGTTGTGGTGGTGGTAGG - Intronic
913086857 1:115446896-115446918 TTGCTTGTTGGTCTTGAGGATGG + Intergenic
913972206 1:143423842-143423864 CAGCGGGTTGATGTGGAGGAGGG + Intergenic
914066587 1:144249455-144249477 CAGCGGGTTGATGTGGAGGAGGG + Intergenic
914112566 1:144716899-144716921 CAGCGGGTTGATGTGGAGGAGGG - Intergenic
914719839 1:150280823-150280845 CTGCTTTTTTAGGTGGAAGAAGG + Exonic
914725729 1:150325801-150325823 CTGTTTGAGGCTGTGGAGGAAGG + Exonic
915157978 1:153894129-153894151 CTACCTGTTGGAGTGGAGGAGGG + Intronic
916367597 1:164050470-164050492 CTTCTTTTTGATGGGGAAGATGG + Intergenic
917385247 1:174465772-174465794 ATGCATGTTGTTGTGGTGGAAGG - Intronic
917764855 1:178204563-178204585 CTACTTGCTGATGTTGATGATGG + Intronic
919880879 1:201899762-201899784 CAGCGTGTTGTTCTGGAGGAGGG + Exonic
921560537 1:216653194-216653216 AAGTTTGTTGATGTGAAGGATGG - Intronic
922080384 1:222290100-222290122 CTGCTGGTTCATGTGCAGGCAGG - Intergenic
922591175 1:226778384-226778406 TTGCTTATTGTTTTGGAGGAAGG + Intergenic
922668938 1:227494591-227494613 GTGCTTGTGGATGTGGAGCCGGG - Intergenic
922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG + Intergenic
924832690 1:247614723-247614745 GTGCTTGTTGATGTGACTGAAGG + Intergenic
1069198294 10:65581728-65581750 CTGCTTCTTGTTGTGTGGGATGG - Intergenic
1070972395 10:80578356-80578378 CTGTTTGTTGTGGGGGAGGAGGG + Intronic
1072990579 10:100188607-100188629 CTGCTTGATGATGAGAGGGAGGG - Exonic
1073039096 10:100587304-100587326 CTCCTCGGTGATGTAGAGGAAGG - Intergenic
1074589238 10:114796999-114797021 TAGGATGTTGATGTGGAGGATGG - Intergenic
1074860101 10:117503532-117503554 CTGCTTGCTGGTGTGGGGGGTGG + Intergenic
1075501422 10:122978710-122978732 ATGGGTGTGGATGTGGAGGATGG + Intronic
1076018902 10:127053873-127053895 CTGCTTGTTTTTTTGGGGGATGG + Intronic
1076615553 10:131751999-131752021 TTGCTTCTTGATATGGAGGGCGG - Intergenic
1076842013 10:133050367-133050389 CTGCCTGCTGGTGTGGAGGTGGG - Intergenic
1076842096 10:133050678-133050700 ATGCTTTCTGATGAGGAGGAGGG + Intergenic
1078734755 11:14009782-14009804 CTGCATCTTCATGTGGAGGAAGG + Intronic
1078918786 11:15807248-15807270 TTGCCTGTGGCTGTGGAGGAGGG - Intergenic
1083671848 11:64304355-64304377 CTGAGTGTTAAGGTGGAGGATGG - Intronic
1083989683 11:66239237-66239259 CTGCTCATAGATGGGGAGGAGGG - Exonic
1084961379 11:72718504-72718526 CTGCATTTTGAGGTGGAGGTGGG - Intronic
1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG + Exonic
1088685805 11:112283727-112283749 CTACTAGGTGATGTGGAGGGAGG + Intergenic
1088756253 11:112887689-112887711 CTGCTTTTTGATGGGGATTAGGG - Intergenic
1088759178 11:112913098-112913120 GTGCTGGCTGAGGTGGAGGAAGG - Intergenic
1088936228 11:114402893-114402915 CTGCTAGGAGATGTGGAGGTAGG - Exonic
1089690448 11:120183789-120183811 CTGCATGATGATGGGGATGATGG - Intronic
1090713185 11:129406583-129406605 GTGCTTGGGGAGGTGGAGGAGGG + Intronic
1091206316 11:133823642-133823664 CTCCTGGTGGTTGTGGAGGAGGG - Intergenic
1093713172 12:22351039-22351061 GTTCTTGTTGAAGTGCAGGACGG - Intronic
1098001034 12:65943631-65943653 CTGCTTGGTATTGTGGAAGAGGG - Intronic
1099576524 12:84390589-84390611 CTGCTGGATGAGGTGAAGGAGGG + Intergenic
1100188599 12:92164961-92164983 ATGCTTGTTGATCTAGATGAGGG - Intergenic
1102285575 12:111653644-111653666 CCTTCTGTTGATGTGGAGGAGGG - Intronic
1103188019 12:118978556-118978578 TTGCTTGGTGGGGTGGAGGATGG - Intergenic
1107029548 13:35836661-35836683 CTGCTCGTTGATACCGAGGACGG - Intronic
1107659765 13:42626755-42626777 CTGCTGGATGCTATGGAGGAGGG - Intergenic
1112013304 13:95310046-95310068 TTGCTTGTTGATGTTCTGGAGGG + Intergenic
1112210784 13:97375082-97375104 GTGCAGGTGGATGTGGAGGACGG + Intronic
1113008094 13:105730472-105730494 CAGCTGGGTGATGTGGTGGAGGG + Intergenic
1113749632 13:112768244-112768266 CTGCTGGTAGAGGTGGAGGCGGG - Intronic
1114844191 14:26301192-26301214 CTGCATCTTCATGTGGTGGAAGG - Intergenic
1116028213 14:39538658-39538680 CTGCTTGGTGATGAGCAGGGGGG - Intergenic
1117570735 14:57046295-57046317 CTGCTTGGTGGTGAGGAGGATGG - Intergenic
1117720956 14:58628266-58628288 ATGTTTGTTGAATTGGAGGAAGG - Intergenic
1119293639 14:73516124-73516146 ATGACTGTTGATGTGGAAGATGG - Intronic
1119293703 14:73516599-73516621 ATGACTGTTGATGTGGAAGATGG - Intronic
1119434652 14:74589992-74590014 CTTATTGTTAATGTGAAGGATGG - Intronic
1122010898 14:98746059-98746081 CTGCTTGCTGCTATGAAGGAAGG + Intergenic
1122513447 14:102288823-102288845 CTGCTTCTTGATCTGGAAGCAGG + Intronic
1125198569 15:37077243-37077265 CAGCTTGTTTATGAGGAGGGAGG + Intronic
1127937541 15:63656652-63656674 CTGTTTCTTGATCTGGAGGGCGG - Intronic
1128458501 15:67847787-67847809 CTTCTTGTTGTTGTGCAGAACGG - Intergenic
1128549170 15:68586725-68586747 CTGCTTGGTGATAGGGAGGGTGG + Intronic
1128602704 15:69011271-69011293 CAGCTTGTGGGTGTGAAGGAAGG + Intronic
1131253753 15:90847853-90847875 CCGCTTGTTGATCTGGATGCTGG - Intergenic
1131418314 15:92280248-92280270 CTGATTCTCCATGTGGAGGAAGG - Intergenic
1132171093 15:99656255-99656277 ATGTTAGTAGATGTGGAGGATGG - Intronic
1132857370 16:2052683-2052705 CTGTTGGTTAATGTGGAGAAGGG + Intronic
1132984618 16:2758255-2758277 CTGCTTGGAGAGGTGGAGGCAGG + Intronic
1133909119 16:10048911-10048933 CTTCCTGCTGACGTGGAGGAAGG + Intronic
1135814512 16:25619900-25619922 CTGCTTGATGTTTGGGAGGATGG - Intergenic
1136849088 16:33599617-33599639 CTGGTGGTCGATGAGGAGGATGG - Intergenic
1138347354 16:56328259-56328281 CTGCTGGTTGAGTTGGAGGGTGG + Intronic
1138405846 16:56793347-56793369 GTGCTTGTTGATGGGAATGAAGG + Intronic
1138810850 16:60148743-60148765 CTGCCTGTTCATGCGGATGATGG - Intergenic
1139026535 16:62824768-62824790 CAGGTAGTTGATGTGGAAGATGG + Intergenic
1140205254 16:72928080-72928102 GTGCTCAATGATGTGGAGGATGG + Intronic
1140666401 16:77231926-77231948 TTGCTTGTTCTTGTGGTGGATGG - Intergenic
1203110795 16_KI270728v1_random:1448267-1448289 CTGGTGGTCGATGAGGAGGATGG - Intergenic
1142534250 17:602906-602928 CTGCTTGGTGCTGGGGACGAGGG + Intronic
1143849534 17:9799842-9799864 CTGTTTCTTGAGGTGGAGCACGG + Intronic
1146253464 17:31372525-31372547 CTGTTTCTTGATGTAGATGATGG - Intronic
1146648485 17:34591414-34591436 CTACTTGGGGATGTGGAGGTGGG - Intronic
1147410119 17:40244663-40244685 CTACTTTTGGATTTGGAGGATGG + Intronic
1148533549 17:48418499-48418521 CTGCTTGTGGAAGTGGAAAATGG + Intronic
1149103019 17:52928590-52928612 TTTATTTTTGATGTGGAGGAGGG - Intergenic
1149918427 17:60633334-60633356 CTGAGTGTTTATGTTGAGGACGG - Intronic
1150666726 17:67146903-67146925 CTGCTTCCTGATGTGGATTAGGG + Intronic
1150932796 17:69603554-69603576 ATGCTGGTAGATGTGGAGGATGG + Intergenic
1151437644 17:74107958-74107980 CTGCTGGATGATGTGAAGGCTGG - Intergenic
1151774897 17:76193900-76193922 CTGTCTGTGGATGTGGAGGTGGG - Intronic
1158010249 18:52720021-52720043 CTCCTGCTTGATGTGGAGAAAGG + Intronic
1158206681 18:55000752-55000774 CTACTTGTGGATGGGGAGCATGG - Intergenic
1158233007 18:55279580-55279602 CTGGTTGCTGGTTTGGAGGAAGG + Exonic
1159700383 18:71619024-71619046 CTGCTGGTTGATCAGGATGATGG + Intergenic
1160958831 19:1708187-1708209 CTGGCTGTGGAGGTGGAGGAAGG - Intergenic
1162185884 19:8904462-8904484 CTGCCTGTTGAGGTGGGGAATGG + Intronic
1162589149 19:11579172-11579194 CTCCTGGTTGGCGTGGAGGAAGG - Intronic
1163401280 19:17094492-17094514 CTGCTTGGGGATGTGGAGTGGGG - Intronic
1165031677 19:33002248-33002270 CTGGTGGTCGATGAGGAGGATGG + Exonic
1165941567 19:39417058-39417080 CTGTTGGTTCATCTGGAGGATGG + Intronic
1168140723 19:54385014-54385036 CAGCTTGTTCAGGTGGTGGACGG - Intergenic
1168419622 19:56192807-56192829 CTGCTCTTTGGTGTGGAGGTCGG + Exonic
1168421344 19:56206137-56206159 CTGCTCTTTGGTGTGGAGGTCGG - Exonic
1168424115 19:56224801-56224823 CTGCTCTTTGGTGTGGAGGTCGG + Exonic
1168426599 19:56244266-56244288 CTGCTCTTTGGTGTGGAGGTCGG - Exonic
925527239 2:4816271-4816293 TTGCTTGTTTATGTGAAAGATGG + Intergenic
925616267 2:5747167-5747189 TTGGTTGCTGATGTGGAGGATGG - Intergenic
926214776 2:10898174-10898196 CTGGATGCTGATTTGGAGGAAGG + Intergenic
926929934 2:18026988-18027010 CTGCTTGTGCCTGTGGTGGATGG + Intronic
926938435 2:18110651-18110673 CAGCCTGTTGTTTTGGAGGAAGG + Intronic
928088343 2:28359367-28359389 CTTCTGGTTTATCTGGAGGAAGG + Intergenic
928446486 2:31337861-31337883 CCACTTGATGATGTGGAGGCAGG - Intronic
929247327 2:39717093-39717115 CTGCCTGCTGATGTGGAACATGG + Exonic
929733863 2:44524576-44524598 CTGCTTGATGATGAAGATGAGGG - Intronic
931764252 2:65440580-65440602 CTCCTTGTTGATGAGAAGAATGG + Intergenic
934656828 2:96120695-96120717 GTGCTTGGTGATGTGGAGTAGGG - Intergenic
937477318 2:122227202-122227224 GTGCTTGTTGAAGAGGAAGAAGG + Intergenic
940903784 2:159150397-159150419 CTGCTTGTTAGTGTGGAGCAAGG - Exonic
941548539 2:166885178-166885200 TTGTTTGTTCATGTGGAAGAAGG + Intergenic
943013036 2:182475157-182475179 ATGCTTGTTGAAGTAGTGGAAGG - Intronic
943976135 2:194480244-194480266 TTGCTTGTTTATTTTGAGGAAGG + Intergenic
944783947 2:203048466-203048488 CTGATTTTTGATGGGGAGGGAGG + Intronic
946059079 2:216926412-216926434 CTGCTTTTTCATCTGGATGATGG - Intergenic
946764037 2:223023507-223023529 CTACTTGTAGATGTGTAGGTTGG - Intergenic
947558040 2:231115580-231115602 CTGCTTGTTGAATTGGGGGTAGG + Intronic
947707590 2:232289055-232289077 CTGCTTGGTGGCGTGGGGGAGGG + Intronic
947869786 2:233428168-233428190 CTGCTGGTTGGTGTGGGGGCTGG + Intronic
948331636 2:237171502-237171524 CTCCTGGTTGCTGTGTAGGAGGG - Intergenic
1168757556 20:327104-327126 CTGCTGGTGGCTGTGCAGGAGGG - Exonic
1172125804 20:32624599-32624621 ATGCTTGGTGAAGGGGAGGAAGG - Intergenic
1172179414 20:32992018-32992040 CTGTTCTTTGATTTGGAGGAAGG + Intronic
1173748187 20:45454154-45454176 GTGTTCGTTGATTTGGAGGACGG + Intergenic
1174465226 20:50712134-50712156 CTGCTTCTTGATGAAGAGGGAGG + Intergenic
1174775247 20:53337755-53337777 CTGCTTTTTGATGTAGAGTAGGG + Intronic
1174831312 20:53814804-53814826 GTGTTTGTAGATGTGCAGGAAGG + Intergenic
1178720953 21:35008358-35008380 ATGCTAGTTGCTATGGAGGAGGG - Intronic
1179645880 21:42775830-42775852 CTGGGTGCTCATGTGGAGGAAGG + Intergenic
1181531480 22:23519974-23519996 CTGCTTGTGCATCTGGACGACGG - Intergenic
1181844713 22:25698026-25698048 CTGCTTGATGCTGTGGGGGAAGG + Intronic
949579842 3:5376935-5376957 CTGCAGCTTGACGTGGAGGAGGG + Intergenic
949957192 3:9278946-9278968 GTGCTGGGTGATGTGGAGGTGGG - Intronic
949985790 3:9539510-9539532 CTGGTTGTTGGTGGAGAGGATGG - Intronic
951055191 3:18139283-18139305 CTGACTGCTAATGTGGAGGATGG + Intronic
952865744 3:37854140-37854162 CTGCCTGCTGATGAAGAGGAAGG - Intergenic
953546234 3:43865524-43865546 AAGCTTGTTGCTGGGGAGGATGG + Intergenic
955405632 3:58623998-58624020 CTGCTGATTGGGGTGGAGGACGG + Intronic
956019762 3:64921680-64921702 CTTTTTGTGGATGGGGAGGACGG + Intergenic
956023212 3:64954494-64954516 CTGCTTCTTGATCTGGATGCTGG + Intergenic
960371478 3:116846324-116846346 CTGCTTGTTGATGTGGAGGAGGG + Intronic
963572128 3:147010713-147010735 CTGCTTGTTGATTTTTAGAATGG - Intergenic
965826971 3:172741307-172741329 ATAATTTTTGATGTGGAGGATGG - Intergenic
967090364 3:186129841-186129863 CTGCATGTGGAAGTGGGGGATGG - Intronic
967933328 3:194706569-194706591 CTGCTGTGTGGTGTGGAGGAAGG + Intergenic
969267225 4:6072456-6072478 CTGATGGCTGCTGTGGAGGAGGG + Intronic
972631603 4:40846804-40846826 CTGCTTACTAATGAGGAGGAGGG + Intronic
977122573 4:93121265-93121287 CTGTTTCTTGATCTGGATGATGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
979482330 4:121234456-121234478 CTGCTTCTTGATGTGGGTGCTGG - Intergenic
980330880 4:131409385-131409407 ATGCTTTTAGATGTGGAAGATGG - Intergenic
980989394 4:139726036-139726058 CTGTTTCTTGATGTGGGGGCTGG - Intronic
981018957 4:140005070-140005092 GTGCTGGTGAATGTGGAGGACGG + Intronic
981551511 4:145946242-145946264 TTGCTTGTTGTTTTAGAGGAAGG + Intergenic
982010229 4:151099071-151099093 CTGCTTGTTGATGTGGATGCTGG - Intergenic
987688522 5:21236768-21236790 CTTCTTGTTGATGTTGAAGTTGG + Intergenic
988401698 5:30769815-30769837 TTGCTTCTGGAAGTGGAGGAGGG - Intergenic
988655550 5:33207614-33207636 CTTCTTGCTGATGTGGAGAAAGG + Intergenic
988669739 5:33368525-33368547 CTTCTTGCTGATATGGAGAAAGG - Intergenic
989415307 5:41168375-41168397 TTGCTTGTTGATTTGCTGGAGGG + Intronic
990575983 5:57123904-57123926 TTTCTTGTTGTTGTGGAGGAAGG + Intergenic
991513646 5:67409296-67409318 CTGCTTGGAGCTCTGGAGGAAGG - Intergenic
992838549 5:80664557-80664579 TTGGCTGCTGATGTGGAGGAAGG + Intronic
993465848 5:88245745-88245767 ATGTTTGGTGATTTGGAGGAAGG - Intronic
993772468 5:91946945-91946967 CTACTCGGTGATGTTGAGGAGGG - Intergenic
993805750 5:92406963-92406985 CCTATTGTTGATGTGGAGAAAGG + Intergenic
994512465 5:100722427-100722449 CTGCTTTTTGAAGTTGAGGTAGG + Intergenic
998165250 5:139838927-139838949 CTCCCTGTTGATGTGGGGGTGGG - Intronic
999270904 5:150295839-150295861 CAGCTTGTGGATGAGCAGGATGG - Intergenic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1003563931 6:7206650-7206672 CTGCTGTGTGCTGTGGAGGAAGG + Intronic
1003684980 6:8293800-8293822 GTGCAGGTTAATGTGGAGGAAGG + Intergenic
1003689423 6:8337908-8337930 CTACTTCTTGATATGGAGAAAGG - Intergenic
1004240336 6:13915734-13915756 CTGCCTGTTGATTTGGCTGATGG - Intergenic
1004402857 6:15304872-15304894 CTGCTTGGTGAGGTGCAGGGAGG + Intronic
1004952637 6:20691360-20691382 CTGCTTGGTGATGTTGGAGAGGG + Intronic
1005827712 6:29644934-29644956 CTGGTGGTTAATGGGGAGGAGGG + Intergenic
1005870682 6:29972348-29972370 CTGCCTGTTGAAGAGCAGGAAGG + Intergenic
1006947190 6:37792533-37792555 CTGTATCTTGATGTGGAGGGCGG - Intergenic
1007327854 6:41075633-41075655 CTATGTGATGATGTGGAGGAAGG - Intronic
1008615465 6:53221737-53221759 CTGCTTTCTCCTGTGGAGGAGGG - Intergenic
1009501734 6:64421943-64421965 ATGTTTCTTGATGGGGAGGATGG - Intronic
1012559710 6:100565554-100565576 CTGCTTTTTTATTTGGAGGTAGG + Intronic
1012776508 6:103500852-103500874 CTGCTTGTTGGTGGGGATGAGGG - Intergenic
1013297735 6:108774618-108774640 CTGCATTCTGATCTGGAGGAGGG + Intergenic
1014788097 6:125640876-125640898 CTGCCAGTGGATGAGGAGGAGGG - Intergenic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1015434693 6:133172477-133172499 CAGGCTGTTGGTGTGGAGGAGGG - Intergenic
1015569720 6:134608347-134608369 GGGTTTGCTGATGTGGAGGAAGG - Intergenic
1017035235 6:150261242-150261264 TTGCTAATTGATTTGGAGGAAGG - Intergenic
1017847411 6:158271340-158271362 TGACTTGTTGATGAGGAGGAAGG + Intronic
1020562475 7:9747002-9747024 CCGCTTGTTGATGATGATGATGG - Intergenic
1021122746 7:16815361-16815383 CTTCTTGTAGAAGTGGAAGAAGG + Intronic
1021931940 7:25589810-25589832 CTGTTTGGGGGTGTGGAGGAAGG - Intergenic
1022391403 7:29947575-29947597 CTGCTTGATTGTGGGGAGGAGGG - Intronic
1023010986 7:35924758-35924780 CTGCTTGGTGTTTGGGAGGAGGG + Intergenic
1023142673 7:37117853-37117875 CTTCTAGGTGATGTGGAGAAAGG - Intronic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1024080139 7:45849085-45849107 CTGCTTGGTGTTTGGGAGGAGGG - Intergenic
1025114895 7:56249178-56249200 CAGCTTGTTGATGTGGAGCTGGG - Intergenic
1025124618 7:56334860-56334882 CTGCTTGGTGTTTGGGAGGAGGG + Intergenic
1026127869 7:67595406-67595428 TTGCTTGGTGAGGTGGAAGATGG + Intergenic
1026199143 7:68199006-68199028 CAGCTTATTGATGTGGAGTTGGG - Intergenic
1029488832 7:100859258-100859280 CAGCTTGTTGGGGTGGAGGGTGG + Intronic
1029555257 7:101264462-101264484 CTGCTTGGTGTTTGGGAGGAGGG + Intergenic
1029891970 7:103939940-103939962 CTGCTTGTTGAACTGGATGAAGG + Intronic
1030599493 7:111577445-111577467 CTGCCTGTTCTTGTGGAGTATGG - Intergenic
1031023307 7:116651589-116651611 ATCCTTGTTGATGGTGAGGAAGG - Intergenic
1031219079 7:118940539-118940561 GTGCATGGTGATGTGTAGGAAGG + Intergenic
1031269165 7:119623422-119623444 CTGCCTGTTGATTTTGAAGATGG - Intergenic
1032505664 7:132432587-132432609 CTGCTTGTTGATGGGGTGTGGGG + Intronic
1032961590 7:137041633-137041655 CTGCTTCTTCATGTGGTAGAAGG + Intergenic
1034286195 7:149884790-149884812 CTACTTGTCAATGTGGAGTATGG + Intergenic
1034677664 7:152903182-152903204 GTGCTGGGTGAGGTGGAGGAAGG + Intergenic
1034784259 7:153910814-153910836 CTGCTTGTTGATGTGGGGATTGG - Intronic
1034873271 7:154702513-154702535 CTGGTTGCTGATATGGAGAAAGG + Intronic
1035544429 8:468613-468635 CTGCTTGTTGATGTGGACCCTGG - Intronic
1035574400 8:695775-695797 GTGCAGGTTGATGGGGAGGAAGG - Intronic
1035593290 8:834664-834686 CTCCTTGTTGTTAGGGAGGAGGG + Intergenic
1036698749 8:10997019-10997041 GTGTTTGTTGATGTGGGAGAGGG - Intronic
1037577975 8:20225772-20225794 CTTCTGGTGGAGGTGGAGGAGGG - Intronic
1037860434 8:22401362-22401384 CTGCTTCTTGGTCTGGAGAAAGG + Intronic
1038266124 8:26041089-26041111 CTGCCTTTTGATGGGGAGAAGGG - Intronic
1039237812 8:35522070-35522092 ATGTTTGTTGATGGGGAGCATGG - Intronic
1040857208 8:51960585-51960607 CTGCTTGAGGATTTGAAGGAGGG + Intergenic
1041012755 8:53559997-53560019 CTGCTTGTTGGGGAGCAGGAGGG - Intergenic
1041117171 8:54551148-54551170 GGGCTTGTTGGTGTTGAGGAAGG - Intergenic
1042480923 8:69301674-69301696 CTCCTTGTGGATTTGGTGGAGGG - Intergenic
1043474546 8:80593453-80593475 CTGTTTGTTTAGGTGGATGATGG + Intergenic
1043782681 8:84355908-84355930 TTGCATGTTGAATTGGAGGAGGG + Intronic
1046063137 8:109163204-109163226 CTGTTTCTTGATGTGGGTGATGG + Intergenic
1050311662 9:4359387-4359409 CTGCTCTTTGCTGTGAAGGAAGG - Intergenic
1050505360 9:6342589-6342611 CTGCTTGGTTCTGTGGAGAAGGG - Intergenic
1050656637 9:7835873-7835895 CTGTTTGGGGATGTGGAGAAAGG - Intronic
1052095680 9:24380917-24380939 ACGTTTGTTGATGAGGAGGATGG - Intergenic
1054941582 9:70748643-70748665 CTGCATCTTCATGTGGTGGAGGG - Intronic
1055275773 9:74613731-74613753 CTGCTTTTTGATGGGGAGAAAGG - Intronic
1055306729 9:74937221-74937243 CTGTTTATTGTTGTGGGGGAGGG + Intergenic
1056959595 9:91111272-91111294 CTTATTGCTGATGTGGAGAAAGG - Intergenic
1057164203 9:92913533-92913555 GTGCATGCGGATGTGGAGGATGG + Intergenic
1057647440 9:96890071-96890093 CTGCCTCGGGATGTGGAGGATGG - Intergenic
1060078107 9:120613336-120613358 CTGCTTGTCTCTGTGGAGGGAGG + Intronic
1060838221 9:126774018-126774040 TTGCTTGCAGATGTGGAAGAAGG - Intergenic
1060944439 9:127561645-127561667 CTGCCTGGTGACGTGGTGGATGG - Intronic
1062483563 9:136763394-136763416 CTCCTTGTAGATGTAAAGGACGG + Exonic
1062681191 9:137782175-137782197 GTGGCTGTTTATGTGGAGGATGG + Intronic
1186257937 X:7742892-7742914 CTAACTGTTAATGTGGAGGACGG - Intergenic
1186516001 X:10166532-10166554 CTGCCTGCTGTTGTGGAGAAAGG + Intronic
1187793723 X:22978872-22978894 CTGGTTCGTGATGTGGAGGCAGG + Intergenic
1189215347 X:39318375-39318397 CTGCTTCTTCATGTGGCAGAAGG + Intergenic
1191116888 X:56861754-56861776 GTGATTGTGGGTGTGGAGGATGG - Intergenic
1191575806 X:62704247-62704269 CTGCTTGGTGATGTGTGGAATGG - Intergenic
1192803324 X:74487734-74487756 CAACAAGTTGATGTGGAGGAAGG - Intronic
1194539928 X:95157264-95157286 CTGCTTGGTGATAAGGAGGGCGG - Intergenic
1196651548 X:118173276-118173298 CTGGATGTTGTTATGGAGGAGGG - Intergenic
1197770408 X:130085821-130085843 TTGCTTGTGGTTGTGGGGGAGGG - Intronic
1199402575 X:147416152-147416174 CTGCTGGCTTATGTGGGGGAAGG + Intergenic
1201604332 Y:15768955-15768977 GTAATTGTTAATGTGGAGGATGG + Intergenic