ID: 960373425

View in Genome Browser
Species Human (GRCh38)
Location 3:116868971-116868993
Sequence AGTCTGTTCTTGATGATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960373425 Original CRISPR AGTCTGTTCTTGATGATACA TGG Intronic
907338059 1:53713501-53713523 AGGCTGGTCTTGAAGAGACAGGG - Intronic
908750167 1:67414432-67414454 AGTCTGTTTTTGATGATTACAGG - Intronic
908853977 1:68403094-68403116 AGTCTCTTCTAGATGTTAAAGGG + Intergenic
910672746 1:89789447-89789469 ATTTTGTTCTTTATGAGACAGGG - Intronic
911716226 1:101136348-101136370 ACTCTGTCCTAAATGATACAAGG + Intergenic
912002467 1:104852209-104852231 ATTCTTTCCTTGGTGATACAGGG + Intergenic
913417974 1:118633526-118633548 AGTCTGTTTTGTCTGATACAAGG + Intergenic
914693271 1:150050759-150050781 AGCCTGTTCTTGGTGATTCAAGG + Intergenic
920933695 1:210411737-210411759 ACTCTTTTCTTTATGACACAGGG - Intronic
923440833 1:234018630-234018652 AGTGTGTTCATGAGGTTACATGG - Intronic
923807174 1:237270098-237270120 GTTCCGTTCTTGATGATACTTGG + Intronic
924198115 1:241631030-241631052 ATACTGTCCTTCATGATACATGG + Exonic
1066106775 10:32163623-32163645 AGTGTATTCTTGATAAGACATGG - Intergenic
1069412826 10:68170652-68170674 AGTCAGGCTTTGATGATACAAGG - Intronic
1069541681 10:69299177-69299199 AGTGTGTTGTTGTTGAAACAGGG + Intronic
1078828490 11:14954777-14954799 AGCCTGTTCTTGCTGCCACAGGG - Intronic
1079870961 11:25797390-25797412 AGTCTATTCTTGATGATGATTGG + Intergenic
1080792149 11:35531045-35531067 GATCTGTGATTGATGATACATGG + Intergenic
1081371759 11:42312942-42312964 AGCCTGTTCATGATTTTACAGGG - Intergenic
1085074868 11:73582090-73582112 AGGTTGGTTTTGATGATACACGG - Intronic
1086862887 11:91946008-91946030 ATTCTCTTCTTAATGATACAAGG + Intergenic
1087073796 11:94109419-94109441 AGTTTGTTCTTAATCTTACAAGG + Intronic
1087249161 11:95876594-95876616 AGACTTTTCTTGATAATAAAAGG - Intronic
1089900928 11:121984061-121984083 AATCTGTTCCTGAGGCTACAGGG + Intergenic
1090557280 11:127890164-127890186 AATCTTTTCTTGATGATTCAGGG + Intergenic
1091349186 11:134879485-134879507 ACTCTGCTCTTGCTGAGACAGGG - Intergenic
1093779321 12:23116184-23116206 AGTCTCTTCCTGTTGATATAAGG - Intergenic
1093986122 12:25535985-25536007 AGTCATTTCATAATGATACAAGG + Intronic
1095279266 12:40331326-40331348 ACTCTGTTCTTTAGGTTACATGG + Intronic
1096642878 12:53008408-53008430 AGTCTGTTCTTGAGGAATCTGGG + Intronic
1099321750 12:81159653-81159675 TATCTGTTCTTGTTCATACACGG - Intronic
1100035495 12:90246146-90246168 AGTCTTTTCTACATGAGACATGG - Intergenic
1100841548 12:98617974-98617996 AGACTGTTCTTGATCATACTAGG - Intronic
1104517888 12:129444662-129444684 TGTCTGTTCATGAGAATACACGG - Intronic
1104731955 12:131111803-131111825 ATTCTGTGTTTGATGAGACAGGG + Intronic
1106121920 13:26867045-26867067 AACCTGTCCTTGATGATACATGG - Intergenic
1108231096 13:48341998-48342020 AGTCAGTTCTTAATGATTGATGG - Intronic
1108827016 13:54424555-54424577 AGATTCTTCTTGATGATTCAAGG - Intergenic
1109890132 13:68600926-68600948 AGTCTGTTCTTTATGTTAGTTGG + Intergenic
1110856927 13:80306796-80306818 ACTCTGTTCTTTAAGTTACAGGG - Intergenic
1111130441 13:83968320-83968342 AGTCTCTGCCTGATGATCCAGGG + Intergenic
1111890105 13:94070737-94070759 AGTCTGTTGCTAATGAGACAGGG + Intronic
1113278886 13:108766828-108766850 AGTTTGTCCTTGAAGATAAAGGG + Intronic
1114072093 14:19120076-19120098 ATTCTGTTCTTGAGGATCCATGG + Intergenic
1114090163 14:19279888-19279910 ATTCTGTTCTTGAGGATCCATGG - Intergenic
1114577605 14:23728291-23728313 AGTCAGTTCTTGATGATTCCTGG - Intergenic
1202882213 14_KI270722v1_random:71246-71268 AGTCTATTCATGTTAATACAAGG + Intergenic
1124663103 15:31567317-31567339 AGTCTGAACTTGATGATTTAGGG + Intronic
1125006340 15:34821996-34822018 CCTCTGTTCTTGAAGATTCAAGG - Intergenic
1125159855 15:36630619-36630641 AGTCTGTTTTTGCTGCTAGAAGG + Intronic
1126217246 15:46170265-46170287 AATTTGTTCTTGATGGCACAAGG - Intergenic
1127870466 15:63068685-63068707 AGTCTGTATCTGATGATCCAGGG - Intronic
1128372049 15:67047538-67047560 AATCTGCTCTGGATGAAACAGGG - Intergenic
1129611157 15:77058638-77058660 GTACTGTTCTAGATGATACAAGG - Intronic
1133138198 16:3726559-3726581 AGTCTGTTCTTTGTAAGACATGG - Exonic
1134099131 16:11439315-11439337 CATCTGTTCTTGATTCTACAGGG + Intronic
1138921267 16:61532132-61532154 ATTCTGTTTTTGATGATTTATGG + Intergenic
1143844746 17:9765672-9765694 ACTCTGTTCTTGTTCAGACATGG + Intergenic
1146527984 17:33583233-33583255 AATCTATTCTTAATTATACAGGG + Intronic
1147499606 17:40950174-40950196 AGGCTGTTCCTGAAGATCCACGG + Intergenic
1148556177 17:48580077-48580099 AGTCTGTTCTTGGGATTACAAGG + Exonic
1148897842 17:50850373-50850395 AGTCTGTTATTGATCATACCAGG - Intergenic
1156741097 18:40329140-40329162 AGTATGTTTTAGCTGATACAGGG - Intergenic
1161888550 19:7016575-7016597 AGTCTGTCCTCGATGACAGAGGG - Intergenic
1162441802 19:10697013-10697035 AGACTGTAGTTGATGCTACAAGG + Intergenic
1164696788 19:30250967-30250989 GGTCTGTCCATGATGTTACACGG + Intronic
1166254558 19:41593107-41593129 AGTCTGTTTTATATGATATAAGG + Intronic
1168222380 19:54969874-54969896 AGTTTGTTCTTGAAGAAGCAGGG + Intronic
1202631333 1_KI270706v1_random:2748-2770 AGTCTATTCATGTTAATACAAGG + Intergenic
1202657824 1_KI270708v1_random:40344-40366 AGTCTATTCATGTTAATACAAGG + Intergenic
931103034 2:59024074-59024096 AGTCACTGCCTGATGATACAGGG + Intergenic
931630719 2:64296148-64296170 ATTCTGCTCTTCATGGTACATGG + Intergenic
931676413 2:64701088-64701110 AATCTGTTCTTCATTGTACATGG - Intronic
931869461 2:66443400-66443422 TGTCTTTTCTTGAAGATAGAAGG - Intronic
932491448 2:72125358-72125380 AGGCTGGTCTTGATGTTACATGG + Intergenic
933293364 2:80462253-80462275 AGTCTGTTGATGATGGTATATGG + Intronic
933478823 2:82827471-82827493 AGTATTTTCTTTATGAAACAGGG - Intergenic
935847692 2:107184706-107184728 ATCCTGTTATTGGTGATACAGGG - Intergenic
936065258 2:109326694-109326716 TATCTGTTCTTGAAGATAGATGG + Intronic
937287505 2:120762573-120762595 AGTCTGTTGCAGATGAGACAGGG - Intronic
939814325 2:146875080-146875102 AGGCTGTTGTTCATGAAACATGG - Intergenic
942113993 2:172709797-172709819 AGTCTGTTCCTGATGGGTCACGG + Intergenic
944639559 2:201709788-201709810 ACTATTTTCTTGATGATTCAGGG + Intronic
946772593 2:223104191-223104213 AGTCTTTTCCTGATGATACAGGG - Intronic
947787073 2:232832719-232832741 ACTCTGTTCATGATGATGCAAGG - Intronic
948216822 2:236238427-236238449 TGTCTCTTCTTAATGATAAAGGG - Intronic
948925416 2:241093460-241093482 AGCCAGTTCTTGTTGACACAAGG - Exonic
948925424 2:241093545-241093567 AGCCAGTTCTTGTTGACACAAGG - Exonic
948925432 2:241093630-241093652 AGCCAGTTCTTGTTGACACAAGG - Exonic
1170904425 20:20500109-20500131 AGTCTTTTTTTGCTGGTACAGGG + Intronic
1173287377 20:41685434-41685456 AGTCTCTTCTTGAGGAGAAATGG - Intergenic
1176727853 21:10457232-10457254 ATTGTTTTCATGATGATACAAGG + Intergenic
1177277017 21:18925243-18925265 ATTCTTTTCTTCATTATACATGG + Intergenic
1178520600 21:33285891-33285913 AGTCTGCTCTTGGTGATTCCAGG - Intronic
1179335957 21:40454119-40454141 AGTCTGCTCATGATGAATCAGGG + Intronic
1180286540 22:10749816-10749838 ATTATTTTCATGATGATACAAGG - Intergenic
1180369381 22:11970533-11970555 AGTCTATTCATGTTAATACAAGG - Intergenic
1180490535 22:15842431-15842453 ATTCTGTTCTTGAGGATCCATGG + Intergenic
1184732038 22:46376011-46376033 AGTGGGTTCCTGATGTTACAGGG + Intronic
949681683 3:6520964-6520986 AGTCTGCTCTTGGTAATGCAGGG + Intergenic
950428848 3:12939340-12939362 TGTCACTTCTTGATGACACAGGG + Intronic
950573123 3:13814328-13814350 AGTCTGTTCATGCTGCTTCAGGG - Intergenic
953653546 3:44828485-44828507 AGTTTGTACTTGAAGTTACATGG - Intronic
953937311 3:47056881-47056903 TGTCTGTCCTTGATAATATATGG + Exonic
956752165 3:72352116-72352138 AGTCTGAACTTGATAAAACATGG - Intergenic
956912352 3:73831315-73831337 AGTTTGTTCTGGAGTATACATGG + Intergenic
957568345 3:81913547-81913569 AGTCTATTCTTTAGGAAACAGGG - Intergenic
960373425 3:116868971-116868993 AGTCTGTTCTTGATGATACATGG + Intronic
964370532 3:155995560-155995582 AGTGTGTGCTGGATGATTCAAGG + Intergenic
965754801 3:172014851-172014873 AGTTTGTTATTGATGAAACAAGG + Intergenic
967663506 3:192143407-192143429 ACACTTTTCTTGATGATAAATGG + Exonic
968849464 4:3069045-3069067 ATTCTCTTCTTGATTATGCAGGG - Intergenic
973140567 4:46763353-46763375 TGTGTGTTCTTTATGTTACATGG + Intronic
973917292 4:55648514-55648536 AGTGTGTTGGTGATGATAAATGG + Intergenic
978162170 4:105562039-105562061 ATTCCCTTCTTGGTGATACAGGG + Intronic
978566884 4:110092235-110092257 CATCTGTTTTTGATGATACTAGG - Intronic
979296420 4:119037465-119037487 TGTCTTTTCTTCAGGATACACGG + Intronic
979580063 4:122347574-122347596 AAGCTTTTCTTGATGATTCAGGG - Exonic
979769117 4:124500641-124500663 GTTCTGTTCTTTATGTTACATGG - Intergenic
979783267 4:124682612-124682634 AGTCATTTCCTAATGATACAGGG - Intronic
981928684 4:150167271-150167293 AGTCTGTCCTTCATAAGACAAGG - Intronic
982670192 4:158311846-158311868 AGTCTGTTTTGTCTGATACAAGG + Intergenic
983125506 4:163946295-163946317 AGTTTGGGCTTGATAATACAAGG - Intronic
983304791 4:165972381-165972403 ATTCTTTTCATGATGCTACATGG + Intronic
986859231 5:11905734-11905756 AGTCTATTCTTTATTATACTTGG + Intergenic
989681362 5:44032869-44032891 AGTCTGTGCTTGATAATCCAGGG + Intergenic
990747955 5:58980585-58980607 AATTTATTCTTGATGATCCAGGG - Intronic
991296061 5:65082688-65082710 TATCTTTTCTTGATGATTCAGGG - Intergenic
1000112311 5:158120645-158120667 AGTCTGCTGTTGATTACACAGGG - Intergenic
1002496111 5:179612717-179612739 AGTCTATTCGTGTTAATACAAGG - Intergenic
1003210206 6:4056667-4056689 AGACTGCTCTTGATTATTCAAGG + Intronic
1005164107 6:22899387-22899409 CTTCTGGCCTTGATGATACAGGG - Intergenic
1005567634 6:27112786-27112808 AGTCTGTCCTTGATGTTAGGAGG - Intergenic
1005860964 6:29900120-29900142 AGTCTAGTCTTGATCATAGAGGG + Intergenic
1006759195 6:36444199-36444221 GGTCTGTTACTGATGATCCAGGG + Intronic
1008076722 6:47153299-47153321 TGTTTGTTATTGATGATAAATGG - Intergenic
1015764590 6:136702501-136702523 TGTCTGTTCTTGATCACATAGGG - Intronic
1016432750 6:144005084-144005106 AAATTATTCTTGATGATACAAGG + Intronic
1017657442 6:156643528-156643550 AGCCTCTTCTTGAAGATAAACGG + Intergenic
1021912089 7:25396452-25396474 AGTGTGTTCTTGAGGATGCTGGG + Intergenic
1022597988 7:31731075-31731097 AGTCTCTTCTTGATGGGGCAAGG - Intergenic
1023480644 7:40630143-40630165 AAACTGTTCTTTATGCTACAGGG + Intronic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1024678530 7:51659807-51659829 AGACAGTTCTTATTGATACAAGG + Intergenic
1030005604 7:105116122-105116144 AGTATGTTTTTGATGAACCATGG + Intronic
1030669138 7:112315592-112315614 AACCTGTTCTATATGATACAGGG - Intronic
1030845722 7:114407907-114407929 AAGCTGTCCTTGATGAAACATGG - Intronic
1031450553 7:121912839-121912861 AGTCTGCTCCTGATCATAAAAGG + Intronic
1034602241 7:152270769-152270791 ATTATTTTCATGATGATACAAGG - Intronic
1036593670 8:10192703-10192725 GGTATGTTCTTGATGTTATAGGG + Intronic
1037645322 8:20787596-20787618 ATGGTGTGCTTGATGATACAGGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041840897 8:62269537-62269559 AGTCTATTCTAGCTAATACAGGG + Intronic
1041880424 8:62743574-62743596 AGTCTGTTCTTCTTTCTACATGG - Intronic
1042365496 8:67931868-67931890 AGTCTGTGGTTGAGGAGACATGG + Intergenic
1043331105 8:79120017-79120039 AGGCTGTCCTTTATGGTACAGGG - Intergenic
1044386875 8:91599424-91599446 AGTAGGTTCTTGATCATTCATGG + Intergenic
1047598841 8:126406378-126406400 AGCCTTTTCTTGATGACTCAGGG + Intergenic
1048546664 8:135393866-135393888 AGTCTGTACTTGATGCTCAAAGG - Intergenic
1050295429 9:4199411-4199433 AGTCTGTTTTATATGATATAAGG - Intronic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1055101942 9:72475040-72475062 AGTCTGCTGTTGGTGAGACAGGG + Intergenic
1187507575 X:19889086-19889108 AGTCTGATATTGATGACACTAGG - Intergenic
1190578892 X:51871153-51871175 AGTCTCTTCTTGAGGAGAAATGG - Intronic
1191062711 X:56316786-56316808 ATTCTGTGCTGGATGATATATGG - Intergenic
1193032768 X:76917486-76917508 TGGCTGCTATTGATGATACAAGG - Intergenic
1193855269 X:86593040-86593062 AGTATGATGTTGATGATAAATGG + Intronic
1194899700 X:99495602-99495624 ATTCTGTTCTTTGTGGTACAAGG - Intergenic
1195506034 X:105658264-105658286 AGTCTCTGCTTGGTGATCCAGGG + Intronic
1196575465 X:117313000-117313022 CGTATGTTCTTGCTGATACGTGG + Intergenic
1197026838 X:121761437-121761459 AGTCATTACTTAATGATACAAGG + Intergenic
1197099452 X:122635910-122635932 AGTCTCTGCTTGATAATACGTGG - Intergenic
1198069101 X:133130383-133130405 AGTCTGCTCTGGATGGTGCAAGG - Intergenic
1200972409 Y:9167246-9167268 ACTCTGTTCTTGCTGTTAAAGGG + Intergenic
1202138612 Y:21697005-21697027 ACTCTGTTCTTGCTGCTAAAGGG - Intergenic
1202244176 Y:22800165-22800187 AATGTGTTCTTGATAATACATGG + Intergenic
1202397164 Y:24433915-24433937 AATGTGTTCTTGATAATACATGG + Intergenic
1202473617 Y:25236177-25236199 AATGTGTTCTTGATAATACATGG - Intergenic