ID: 960373862

View in Genome Browser
Species Human (GRCh38)
Location 3:116874589-116874611
Sequence AAGGGGCTCAGGAAGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 223}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960373862_960373876 21 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373876 3:116874633-116874655 TTGGCTAATGAGGGGCTGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 203
960373862_960373875 20 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373875 3:116874632-116874654 TTTGGCTAATGAGGGGCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 211
960373862_960373877 25 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373877 3:116874637-116874659 CTAATGAGGGGCTGGAGGGCAGG 0: 1
1: 0
2: 1
3: 28
4: 319
960373862_960373873 13 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373873 3:116874625-116874647 CTGGAAGTTTGGCTAATGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 117
960373862_960373872 12 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373872 3:116874624-116874646 TCTGGAAGTTTGGCTAATGAGGG 0: 1
1: 0
2: 1
3: 9
4: 156
960373862_960373870 2 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373870 3:116874614-116874636 TTTCTGGCTTTCTGGAAGTTTGG 0: 1
1: 0
2: 1
3: 41
4: 362
960373862_960373878 28 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373878 3:116874640-116874662 ATGAGGGGCTGGAGGGCAGGAGG 0: 1
1: 1
2: 14
3: 129
4: 1187
960373862_960373871 11 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373871 3:116874623-116874645 TTCTGGAAGTTTGGCTAATGAGG 0: 1
1: 0
2: 2
3: 7
4: 147
960373862_960373867 -6 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373867 3:116874606-116874628 CCCCTTGCTTTCTGGCTTTCTGG 0: 1
1: 1
2: 2
3: 33
4: 398
960373862_960373874 17 Left 960373862 3:116874589-116874611 CCCACATACTTCCTGAGCCCCTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 960373874 3:116874629-116874651 AAGTTTGGCTAATGAGGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960373862 Original CRISPR AAGGGGCTCAGGAAGTATGT GGG (reversed) Intronic
900549586 1:3247564-3247586 AAGGGGCGCAGGAAGGACGGAGG - Intronic
900608002 1:3532312-3532334 AAGGGGCTCAGAGAGGATGGGGG - Intronic
900625336 1:3605927-3605949 AAGGGGCGCAGGAAGCACGGGGG - Intronic
901973079 1:12923531-12923553 AGTGGGGTCATGAAGTATGTGGG - Intronic
902012102 1:13278232-13278254 AGTGGGGTCATGAAGTATGTGGG + Intergenic
902385172 1:16072267-16072289 AAGTGGCTCAGGATGTCTCTGGG - Intronic
902670098 1:17967273-17967295 AAGGTGCTCAAGAAATATGTTGG - Intergenic
902805495 1:18859001-18859023 AAGGGGCTCAGGGAGGAGGTGGG + Intronic
903017711 1:20372056-20372078 ACAGGGCCCAGGAAGTGTGTGGG - Intergenic
903954632 1:27016761-27016783 TAGGTGCTCAGTATGTATGTTGG - Intergenic
904927397 1:34059685-34059707 CAGGTGCTCAGTAACTATGTGGG + Intronic
906712385 1:47940631-47940653 GCGGGGCTCAGGAAGCCTGTGGG - Intronic
906820958 1:48929415-48929437 AAGGGGGGCAGGAAGGAAGTTGG - Intronic
907382816 1:54105209-54105231 AAGAGGCCCAGGAAGCATGGTGG - Intronic
910623612 1:89283559-89283581 TAGGAGCTCAGGAATTAGGTAGG - Intergenic
911072246 1:93841499-93841521 GTAGGGCTCAGGAAGGATGTAGG - Intronic
913041153 1:115025321-115025343 AAGGGGCAGAGGAAATATTTAGG - Intergenic
913323684 1:117607658-117607680 AATGAGCCCAGGAAGTAAGTTGG + Intronic
915339054 1:155166581-155166603 CAGGGGCTGGGGAAGGATGTTGG - Intergenic
915888149 1:159745371-159745393 GAGGGGCTGAGGGGGTATGTGGG + Intergenic
916213754 1:162378999-162379021 AAGGGGCTCGGAAAGCAGGTGGG - Exonic
916248471 1:162711570-162711592 GAGGGGCTTAGGAAGAATGGAGG + Intronic
917931498 1:179825828-179825850 ATGGGGCTCAGTAAATCTGTAGG + Intergenic
918449662 1:184646397-184646419 AATGGGCTCAGAAAGTGTGATGG - Intergenic
919841024 1:201609494-201609516 CAGTGGCCCTGGAAGTATGTGGG + Intergenic
920232528 1:204480107-204480129 AAGGGGATGAGGATGTACGTCGG + Intronic
922095127 1:222436708-222436730 GAGGGGCTCAGGGAGTCTGAAGG - Intergenic
922278313 1:224099892-224099914 AAGGGGGTCAGGGAGGATGCAGG + Intergenic
924046196 1:240033676-240033698 AGGGGGCTCTGCAAATATGTGGG - Intronic
924239682 1:242029311-242029333 AAGGCATTCAGGAGGTATGTGGG + Intergenic
1063185923 10:3651511-3651533 AAGGGGGTCATGAGGTCTGTTGG - Intergenic
1063961208 10:11306915-11306937 AAGGGGCCCAGGGAGTTTCTAGG + Intronic
1068045481 10:51881025-51881047 AAGGGGGGCAGATAGTATGTGGG + Intronic
1068350306 10:55836074-55836096 AGTGTGCTCAGGATGTATGTTGG + Intergenic
1071982478 10:91017724-91017746 AAGGTGCTCAGGGAATATTTGGG - Intergenic
1075012728 10:118888585-118888607 GAGGGGCTCAGGAAGGTGGTGGG - Intergenic
1075306466 10:121372301-121372323 ACGGGGCTTAGGAGGTATATGGG + Intergenic
1075514922 10:123101050-123101072 ACGGGGCTCAGGGAGGCTGTTGG - Intergenic
1078723772 11:13909233-13909255 AATGGGCAAAGGAAGTATGGTGG + Intergenic
1079357475 11:19742139-19742161 AAGGGGCTCAGGAGGGGTGAAGG - Intronic
1079427957 11:20362024-20362046 AAGGGGCTCATGAAGTGCTTAGG + Intergenic
1081761453 11:45579181-45579203 AAACGACTCAGGAAGTGTGTTGG - Intergenic
1085567807 11:77530639-77530661 AAGGTGCGCAGGAAGTATGAGGG - Intronic
1086039168 11:82454221-82454243 AAGGGCCTCAGGAAATATCTGGG - Intergenic
1089669330 11:120042371-120042393 TAGGGGGTGAGGAGGTATGTGGG + Intergenic
1090287690 11:125514269-125514291 AAGGGGCAAAGGAAAAATGTGGG + Intergenic
1097765491 12:63521904-63521926 AGGGGGGTGGGGAAGTATGTTGG + Intergenic
1100002654 12:89856182-89856204 AAGGGGCTCTGCAACTATGCTGG + Intergenic
1100754572 12:97736200-97736222 CAGTGGCACAGGAAGAATGTGGG + Intergenic
1101986112 12:109448557-109448579 AAGGGGCTGAGGCAGAACGTGGG + Intronic
1102168210 12:110822673-110822695 AAGGGGCTCAGGGAGGATGATGG - Intergenic
1103402717 12:120654306-120654328 AAGGGGCTTAGGAAGTTGGAAGG + Intronic
1106081183 13:26501351-26501373 AAGGGGCCCAAGAGGTTTGTGGG + Intergenic
1107554134 13:41502659-41502681 AAGGGGCTTTGGAAATATATTGG + Intergenic
1107986396 13:45780227-45780249 AGGGGGCCCAGGAAGTGGGTGGG - Exonic
1109618686 13:64871952-64871974 TTGGGCCTCAGGAAGTGTGTGGG - Intergenic
1112477481 13:99745009-99745031 AGGTGGCTGGGGAAGTATGTTGG - Intronic
1115445425 14:33484255-33484277 GAGGAGCTGAGGAACTATGTAGG + Intronic
1117337288 14:54766309-54766331 TAGGTGCTCAGTAAGTATCTAGG - Intronic
1118334410 14:64840707-64840729 AAGGAGCTCAGTAAGTGTGTGGG - Intronic
1119184907 14:72633356-72633378 AAGGGAATGAGGAAGTATCTAGG + Intronic
1121830108 14:97044227-97044249 AAGGGCCTCAGAGAGTATGATGG - Intergenic
1125080320 15:35665016-35665038 GAGTGGCTCCAGAAGTATGTAGG - Intergenic
1126129132 15:45323795-45323817 AAGGGGCAGAGGAAAAATGTGGG - Intergenic
1127041854 15:54985506-54985528 CAGTGGCTGAGGAAGTATTTTGG - Intergenic
1127259234 15:57316310-57316332 CATGGGCTCAGGGAGGATGTGGG + Intergenic
1127628385 15:60802449-60802471 ATGGGCCTCATGAAGTATTTAGG - Intronic
1128214283 15:65923482-65923504 GAGGGGCTCAGAGAGTAGGTAGG + Intronic
1130034232 15:80342781-80342803 ATGGGGCTGGGGAAGTATGGAGG - Intergenic
1130410356 15:83642780-83642802 GAGGTGCTCAGGAAGTGTGTTGG + Intergenic
1131530339 15:93185560-93185582 AAGGGGCAAAGGAAAAATGTGGG - Intergenic
1132120651 15:99172438-99172460 AAGGGACACAGGAAGAATGAAGG - Intronic
1136394784 16:29987043-29987065 AGGGGGTTCAGGAGGGATGTCGG - Exonic
1138759740 16:59528329-59528351 AAGAAACTCAGGAAATATGTTGG - Intergenic
1139955013 16:70688980-70689002 AGGGGTCTCAGGAAGACTGTGGG + Intronic
1142864963 17:2785142-2785164 AGGGGGCCCAGGAAGAATCTGGG + Intronic
1143221398 17:5265202-5265224 AAGGGGCTCAGTGTGTATGTTGG - Intergenic
1143736238 17:8913789-8913811 AAGGGCCTCAGGATGTCTTTGGG - Intronic
1145159162 17:20562944-20562966 AATGGCCTTAGGAAGTATTTGGG - Intergenic
1145274773 17:21422887-21422909 AAGGAGCTGAGGAGGGATGTGGG + Intergenic
1145312624 17:21708786-21708808 AAGGAGCTGAGGAAGGATATGGG + Intergenic
1146359072 17:32159524-32159546 AAGGGGCCCAGGAAGCCTGTGGG + Intronic
1147668881 17:42165407-42165429 AAGGGACTCTGGAAGGATGGCGG + Intronic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1148178341 17:45585978-45586000 AACGGGCAGAGGAAGTATGGCGG + Intergenic
1148270820 17:46260489-46260511 AACGGGCAGAGGAAGTATGGCGG - Intergenic
1148472093 17:47901006-47901028 AAGGGACTCTGGAAGTGTGTGGG - Intronic
1149941313 17:60870429-60870451 AAGGGTCTCGGGAAGTGTGCAGG + Intronic
1152590060 17:81207207-81207229 AAGAGCATCAGGAAGTCTGTGGG + Exonic
1153816609 18:8795785-8795807 AGGGGGCTCAGGAAGTAGAGGGG + Intronic
1155954377 18:31944549-31944571 AATGGGCAGAGGAAGAATGTGGG + Intronic
1156002631 18:32402511-32402533 AAGTGGCTCAGGAGATCTGTTGG - Intronic
1156477275 18:37413737-37413759 ATGGGGCTCTGGAAGGATGTGGG - Intronic
1157968251 18:52234872-52234894 AATAGGCTCATGAAGGATGTTGG - Intergenic
1159862904 18:73670536-73670558 AAGGAGCTAGAGAAGTATGTGGG + Intergenic
1159869056 18:73740079-73740101 TAGAGGCTCAGCAAGAATGTGGG - Intergenic
1160568251 18:79799789-79799811 CAGGCGCACAGGAAGTGTGTGGG + Intergenic
1160842518 19:1152574-1152596 AAGGGACTCAGGAACTAGGGAGG + Intronic
1166904776 19:46100490-46100512 AAGGGGCAGAGGAAAAATGTGGG + Intergenic
1167017446 19:46850379-46850401 AAGGCGCTCTGGAAGTGTGGCGG - Intronic
1167469416 19:49667038-49667060 AGGCGGCTCAGGAAGTCTGTTGG - Exonic
1167515923 19:49923140-49923162 AAGGGGCTCTGGAGGACTGTGGG + Intronic
1167603752 19:50469118-50469140 AAGGGGCTCTGCAGGTCTGTGGG - Intronic
927473730 2:23396326-23396348 ATTGGCCTCAGGATGTATGTGGG - Intronic
932344492 2:70986747-70986769 CAGGTGATCAGGAAGGATGTTGG + Exonic
932774364 2:74518564-74518586 AAGTTACTCAGGAAGTATGGAGG + Exonic
933795209 2:85914046-85914068 ATGGGGCACAGGAACTTTGTAGG - Intergenic
934096772 2:88614138-88614160 AAGGCTTTCAGGAGGTATGTAGG - Intronic
935179485 2:100677002-100677024 GAGGGACTCAGAAAGTAGGTGGG - Intergenic
937030772 2:118738286-118738308 TAGGTGCTCAGTAAGTATTTTGG + Intergenic
938379695 2:130829564-130829586 ATAGGGATCAGGAAGTGTGTGGG - Intergenic
938951566 2:136259356-136259378 AAGGGCCTCAGGATGGATGCTGG - Intergenic
939580951 2:143945276-143945298 AAAGAGCTCAGGAACTATTTTGG - Exonic
939771565 2:146326431-146326453 AATTAGCTCAGGAAGTATATTGG - Intergenic
939865787 2:147471008-147471030 TAGGTGCTCAGTAAATATGTGGG - Intergenic
940318521 2:152349638-152349660 AAGGGACTCAGGATGTAGCTGGG + Intronic
940393537 2:153161492-153161514 AAGGGGATCAGGAGGGATGAGGG + Intergenic
942297005 2:174527545-174527567 CAGAAGCTCAGGGAGTATGTGGG + Intergenic
945449348 2:209976042-209976064 AAAGGGCTCTGGATGTAGGTTGG + Intronic
946089640 2:217209423-217209445 AAGGATCTCAGGAAAAATGTAGG - Intergenic
946128967 2:217590786-217590808 AAGGGAACCAGAAAGTATGTGGG - Intronic
947061172 2:226167917-226167939 GAGGGGCTCGGGAAGAATATTGG - Intergenic
1170699381 20:18689578-18689600 AATGGGGGCAGGAAGGATGTTGG + Intronic
1172124119 20:32614991-32615013 AAGGGGAGTAGGAAGTAGGTGGG - Intergenic
1172774064 20:37397142-37397164 AAGGGGCGCAGGGAGCAGGTGGG - Intronic
1173285755 20:41670260-41670282 AAGGGGCTCAGGTCATAGGTAGG + Intergenic
1175810844 20:61856571-61856593 AGGGGGCTGGGGAAGAATGTGGG - Intronic
1175810859 20:61856621-61856643 AGGGGGCTGGGGAAGAATGTGGG - Intronic
1176139736 20:63539731-63539753 AAGTGGCTCAGGAAGCCTCTGGG - Intergenic
1176273474 20:64248544-64248566 AAGGGGCTGAGGACGTAGGGCGG + Intergenic
1176286009 21:5020148-5020170 AAGGGGCTAAGGAACTTTCTGGG + Intergenic
1178114912 21:29407185-29407207 AAGGGGATCATGAAGTATGAAGG + Intronic
1179871172 21:44243327-44243349 AAGGGGCTAAGGAACTTTCTGGG - Intergenic
1180038465 21:45263441-45263463 GAGGGGCTCAGGAAGGCTGGGGG - Intergenic
1180592100 22:16949084-16949106 AGGGAGCTCAGGAGGTATCTAGG - Intergenic
1181040980 22:20192531-20192553 AGGGAGCTCAGGATGCATGTGGG - Intergenic
1182767484 22:32768727-32768749 AATGGGCTCAGGAAGTACTATGG - Intronic
1183301964 22:37062984-37063006 AAGGCCCTCAGGCAGTATATAGG + Exonic
1184110662 22:42392222-42392244 AAGGGGCTGAGGAGGTGTGATGG + Intronic
1184817622 22:46884231-46884253 AAGGGGCTGTTGAAGTAGGTGGG + Intronic
955507729 3:59648645-59648667 CAGTGACTGAGGAAGTATGTTGG + Intergenic
956017459 3:64898579-64898601 AAGGGGGAGAGGAAGTATGAAGG + Intergenic
957235816 3:77588912-77588934 AAGGGACTCAGTAATTATGCTGG + Exonic
958868580 3:99530311-99530333 AAAGGGCTGGGGAAGTAAGTTGG - Intergenic
959289898 3:104460494-104460516 GAGGGGCTGAGAGAGTATGTAGG - Intergenic
959822709 3:110755608-110755630 AAGGGACTTAGGTAGTAAGTGGG - Intergenic
960296123 3:115946248-115946270 AAGGGGCTCAGTGGGTAGGTAGG + Intronic
960373862 3:116874589-116874611 AAGGGGCTCAGGAAGTATGTGGG - Intronic
961462204 3:127058092-127058114 AAGGGGCTGAGGAGGTTTCTGGG + Intergenic
961806848 3:129495714-129495736 AATGGTCTCAGAAAGGATGTGGG + Intronic
962023734 3:131526666-131526688 AGGCGGCTCAGGAAGTCTGTTGG - Intergenic
962298790 3:134218360-134218382 AAGGTGCTCAGCAAGTAGGAGGG + Intronic
964717295 3:159736014-159736036 CAGGTGCTCAGTAATTATGTTGG + Intronic
968003238 3:195221984-195222006 AAGGGCCTCAGGAAGAACGAAGG - Intronic
968978948 4:3836442-3836464 AAGGGGCTCAGGGAGGTTGGGGG - Intergenic
969667331 4:8567617-8567639 AAGGGGCGAAGGAAAAATGTGGG + Intronic
970641456 4:18070791-18070813 TAAGGGCACTGGAAGTATGTTGG - Intergenic
973643207 4:52923617-52923639 AAGGGATTCAGGAAGTTCGTGGG + Intronic
975846825 4:78533968-78533990 AAGGGGCTCAGGAAGAAGGCTGG + Intronic
978657433 4:111080733-111080755 AAGGGGCTGAGGAAATATTTGGG + Intergenic
979349486 4:119628149-119628171 AAGGGGCTCAGAAACTGTTTGGG + Intronic
982808073 4:159791075-159791097 ATGGAGCTCAGGAAATATTTAGG - Intergenic
982907796 4:161098915-161098937 AAGTGGCTCAAGAACTGTGTGGG - Intergenic
983635864 4:169897230-169897252 AAAGGTCTCAGGAATTATGGTGG + Intergenic
983680841 4:170351776-170351798 AAGGGGCTGAGGTAGGAGGTGGG - Intergenic
985887175 5:2688720-2688742 AAGGGGAGCAGGAAGCATGCAGG - Intergenic
986211571 5:5678404-5678426 AAGCTGCTCAGCAAGTTTGTGGG + Intergenic
987111883 5:14695673-14695695 AAGGAGCTCAGGATGTAAGGAGG - Exonic
988768694 5:34409158-34409180 GAGGGGCTCAGGGACTCTGTTGG + Intergenic
990302234 5:54460380-54460402 AAGAGGCTCAGCATGTCTGTGGG + Intergenic
991215244 5:64152359-64152381 AAGGGGCAAAGGAAAAATGTGGG - Intergenic
991667209 5:69011295-69011317 AAGGGGCTCAGGAGATGTGTTGG - Intergenic
995278094 5:110300906-110300928 AAGGGGCTGGTGAAGTAGGTGGG - Intronic
995461716 5:112410613-112410635 GAGGGGCTCAGGAAGGAAGGAGG - Intronic
996233721 5:121100369-121100391 AAGGGACAAAGGTAGTATGTTGG + Intergenic
997734795 5:136205374-136205396 AAGGGGCTGAGGAAGGATCCAGG - Intergenic
998266880 5:140673282-140673304 AACGGGCAGAGGAAGTATGGCGG - Exonic
999174378 5:149621649-149621671 AAGGGGCTTTGGAAGCATGCAGG - Intronic
1002639381 5:180623487-180623509 AAGAGGCTCTGGAGGTGTGTAGG + Intronic
1003425928 6:5998353-5998375 AAGGGGCTGAGGAAATCTCTGGG - Exonic
1005259494 6:24042836-24042858 AATGGCCTCACCAAGTATGTGGG - Intergenic
1006838596 6:37014150-37014172 CAGGAGCTCAGTAAGTATATGGG - Intronic
1007104443 6:39273845-39273867 AAGGGGCTCTGGAAGGATTGGGG - Intergenic
1008441087 6:51532456-51532478 AATGTGCCCAGGAATTATGTGGG - Intergenic
1008861069 6:56150652-56150674 AGTGGGCTCAGGAAGTGAGTTGG - Intronic
1010636401 6:78264015-78264037 AAGGGGCAAAGGAAAAATGTGGG - Intergenic
1012323419 6:97881973-97881995 AAGGGGTTTCTGAAGTATGTTGG - Intergenic
1013298783 6:108783425-108783447 AAGGAGCTCAGGAAGGATTATGG + Intergenic
1013570957 6:111425062-111425084 GAGGGGCTCTGTGAGTATGTTGG - Intronic
1014621868 6:123676941-123676963 AAGTGTCTCAAGAAGTGTGTAGG + Intergenic
1015062270 6:128981152-128981174 GAGGAAATCAGGAAGTATGTAGG - Intronic
1015573016 6:134641494-134641516 AAGGGGGTGAGGAAGTTTTTAGG - Intergenic
1015691692 6:135931452-135931474 AAAGGGCTCTGAAAGAATGTTGG + Intronic
1016261291 6:142173955-142173977 AAGGGGCTTAGGGAGCAGGTTGG - Intronic
1017177210 6:151516267-151516289 AAGGGTATAATGAAGTATGTTGG + Intronic
1017750135 6:157483675-157483697 AAGTGGCTCAGGAGGTTTGACGG + Intronic
1018955367 6:168406491-168406513 AAAGGGCTCTCGCAGTATGTGGG - Intergenic
1019396619 7:823442-823464 AAGGGGATCAGGAAATAGGAGGG + Intronic
1019641838 7:2107426-2107448 ATGGGGAGCAGGAAGTGTGTCGG - Intronic
1019770891 7:2883122-2883144 AAGGGGGACAGGAAGTTTGCAGG + Intergenic
1020412036 7:7903208-7903230 AAGGGGCTCAGGCTGGAGGTAGG + Intronic
1024506546 7:50167084-50167106 AAGGAGCTGAGGAAGCAGGTAGG + Intergenic
1026257742 7:68727060-68727082 AAGGGCCCCAGGAAGTATGAAGG - Intergenic
1028971634 7:96865366-96865388 AAAGTGCTCTGGAAGTTTGTAGG - Intergenic
1029201288 7:98840747-98840769 AAGGGGGTCAGGGAGGAGGTGGG + Intergenic
1030308796 7:108048020-108048042 AAGGGGCACAGGAAGTGTAGGGG - Exonic
1031323034 7:120357040-120357062 AAGGAGCTCATGAAATATGGAGG - Intronic
1034031206 7:147766090-147766112 AAGAGGCACAGGAAGTTTTTGGG + Intronic
1036597738 8:10229373-10229395 AACTGGCTCAGGAATTCTGTAGG + Intronic
1037017324 8:13924952-13924974 AAGGGGCAAAGGAAAAATGTGGG + Intergenic
1038386645 8:27154575-27154597 AAGGTGCTCAAGAAGGCTGTGGG - Intergenic
1038831137 8:31062079-31062101 ATGGGTCCCAGGAAGAATGTGGG + Intronic
1039925569 8:41928806-41928828 AAGGGGCAGAGGAAGTGTGGAGG + Intergenic
1040869071 8:52081280-52081302 AGGGGGCCCAGGAATTCTGTGGG - Intergenic
1042568788 8:70140255-70140277 GAGGGGCTCAGGTAGGAAGTAGG - Intronic
1043052941 8:75405014-75405036 AGAGGGCTCAGGAAGTAGGGAGG - Intergenic
1044870802 8:96618003-96618025 AAAGTGCTCAGGAAGTATTTGGG - Intergenic
1045546452 8:103133254-103133276 GTGGGGCTCTGGAAGTATGGAGG - Exonic
1048738273 8:137525995-137526017 AGGTGGCTCAGGAGGCATGTGGG + Intergenic
1048970043 8:139640321-139640343 CAGGGGCTCAGGAGGTATTTTGG - Intronic
1049040446 8:140108734-140108756 AAGGCCCTCAGCAAGTATGCAGG + Intronic
1049214811 8:141402688-141402710 AAGGGGAGCAGGAGGTATGGGGG - Intronic
1049929820 9:445600-445622 AATGGGCACGGGAAGTATTTTGG - Intronic
1050375083 9:4962931-4962953 AAGGGACTCAGTCATTATGTTGG - Intergenic
1052755315 9:32534998-32535020 AAGAGGCAAAGAAAGTATGTGGG + Intergenic
1053561897 9:39205027-39205049 AAGGGCTTAAGGAAGTATGTGGG - Intronic
1053827708 9:42043034-42043056 AAGGGCTTAAGGAAGTATGTGGG - Intronic
1054135221 9:61413928-61413950 AAGGGCTTAAGGAAGTATGTGGG + Intergenic
1054602852 9:67144411-67144433 AAGGGCTTAAGGAAGTATGTGGG + Intergenic
1055654633 9:78440200-78440222 AAGGGGCTCAGTGAGTCTCTGGG + Intergenic
1055743465 9:79415733-79415755 AAGGGGGGCAAGAGGTATGTAGG + Intergenic
1057146811 9:92764355-92764377 AGGGGGCACGGGCAGTATGTGGG - Intronic
1062097993 9:134712542-134712564 AGGGGGCTCAGGAAGGACGGGGG - Intronic
1186938007 X:14472519-14472541 AAGAGGTTCAGGAAGGAGGTGGG - Intergenic
1187552962 X:20324300-20324322 ATGGGGGGCAGGAAGTATATGGG - Intergenic
1187609070 X:20920721-20920743 AAAGGACTCAGTATGTATGTGGG - Intergenic
1192373460 X:70535056-70535078 AATGGGGCCAGGCAGTATGTGGG + Intronic
1193626617 X:83829867-83829889 AAAGGGTTCAGGAAATATTTGGG + Intergenic
1194659692 X:96616118-96616140 AGGTGGCTCAGAGAGTATGTGGG + Intergenic
1194965107 X:100279403-100279425 AAGGGGCTCATGGACTATTTGGG - Intergenic
1195158915 X:102152472-102152494 AAGGGGATGAGGAAGGAAGTGGG + Intergenic
1196180902 X:112688383-112688405 AAGTGGCTCAGGAAGGATGTGGG + Intergenic
1196200013 X:112875580-112875602 AAGGGGATTAGGAAGTATCCCGG + Intergenic
1196263128 X:113609122-113609144 GAGGGGCTAAGCAAGTAGGTTGG - Intergenic
1196359639 X:114837197-114837219 ACTGGCCTCATGAAGTATGTTGG + Intronic
1197909772 X:131468750-131468772 AGGGGGCTAGGGAAGTATATGGG - Intergenic
1198517106 X:137420659-137420681 AAGGGATTCAGTAAATATGTGGG - Intergenic
1199154454 X:144530161-144530183 ATGGGGCACAGGAAGAATGCAGG - Intergenic
1201452656 Y:14133159-14133181 AGGAGGCTAAGGAAGGATGTAGG + Intergenic