ID: 960374434

View in Genome Browser
Species Human (GRCh38)
Location 3:116881096-116881118
Sequence AAGCTGAGCATATTTTAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960374433_960374434 -9 Left 960374433 3:116881082-116881104 CCTCGAGTGGGTACAAGCTGAGC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 960374434 3:116881096-116881118 AAGCTGAGCATATTTTAGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960374434 Original CRISPR AAGCTGAGCATATTTTAGCG TGG Intronic
908568912 1:65388174-65388196 AAGCTGAGCCTATTCTAACTGGG + Intronic
908619236 1:65958303-65958325 AAGTTGAGCTTATTTTAGGAAGG - Intronic
911243573 1:95491740-95491762 AAGAAGAGCTTATTTTAGTGAGG + Intergenic
913067062 1:115265856-115265878 AAGCTAAGCATCTGTTAGCCTGG + Intergenic
913696693 1:121333250-121333272 AAGCTGAGCTTATTTGAGTAGGG + Intronic
914140867 1:144946810-144946832 AAGCTGAGCTTATTTGAGTAGGG - Intronic
916429736 1:164715981-164716003 AAGCAGAGATTATTTTAGTGGGG + Intronic
917528314 1:175809694-175809716 AGCCTGAGGATATTTTACCGTGG - Intergenic
920484024 1:206351604-206351626 AAGCTGAGCTTATTTGAGTAGGG + Intronic
921890811 1:220352071-220352093 AAACTGAGCCTATTTTGGCAAGG - Intergenic
922173531 1:223177386-223177408 CAGCTAAGAATATTTTAGTGAGG - Intergenic
1064370642 10:14749438-14749460 ATGCTGAGTAGATTTTAGCCAGG - Intronic
1075798875 10:125140103-125140125 TAGCTTAGCAGATTTCAGCGGGG - Intronic
1080443300 11:32314635-32314657 AAGCTGAGCATCTTTTTATGAGG - Intergenic
1080940577 11:36913516-36913538 ACACTGAGCATATTTTAGCTGGG + Intergenic
1091093478 11:132794226-132794248 ACACTGAGCATATTTCAGCATGG + Intronic
1091564466 12:1638298-1638320 AAGCTGAGCATAGTAAAACGAGG + Intronic
1092790462 12:12066363-12066385 CAGATGAGCAGATTTTAGAGTGG - Intronic
1093670764 12:21872500-21872522 AAGCTGTGCTTATTTCTGCGTGG + Intronic
1095682128 12:44990053-44990075 AAGCTGAGAATATAGTAGCTTGG + Intergenic
1099456864 12:82873905-82873927 AAGCTGGGCATATTTTAGGATGG - Intronic
1100652541 12:96606149-96606171 GAGCTGAGCCTATTTTAGACGGG + Intronic
1101578840 12:106023242-106023264 AATCTGAGCATGGTTTAGCTGGG - Intergenic
1101868502 12:108542185-108542207 AAGTTGAGCATCTTTTCACGTGG - Intronic
1104185855 12:126430396-126430418 AAGCAGTTCATATTTTACCGTGG - Intergenic
1106703437 13:32254739-32254761 ATGCTTAGCATATTTTACCCAGG - Intronic
1107819040 13:44269783-44269805 AAGCTGATCTTATTTAAGAGTGG + Intergenic
1108153629 13:47562977-47562999 AACCTAAGCAGATTTTAGCAGGG - Intergenic
1110050368 13:70889195-70889217 AAACTGCGCATATTTCAGTGTGG - Intergenic
1119832058 14:77712125-77712147 CAGCTGAGCACAGTTTAGCTGGG + Intronic
1120229253 14:81825020-81825042 AACCTGAGCATATTTATGCTAGG + Intergenic
1124550538 15:30676887-30676909 AAGCTGATCATGTTTCAGCAGGG + Intronic
1124681358 15:31733922-31733944 AAGCTGATCATGTTTCAGCAGGG + Intronic
1126345813 15:47692964-47692986 AAGCTGAAAATATTTGAGGGTGG - Intronic
1126419393 15:48455475-48455497 ATGCTGAGCATGTTTGAGAGGGG + Intronic
1131777793 15:95821423-95821445 GAGCTGAGCATTTTTTACAGAGG + Intergenic
1140747163 16:77990940-77990962 TAGTTGTGCATATTTTGGCGTGG - Intergenic
1146826655 17:36028966-36028988 AAGCTGAGCACCTTTTGGCCTGG - Intergenic
1148692558 17:49539552-49539574 AAGTGAAGCATAATTTAGCGAGG + Intergenic
1149217025 17:54369693-54369715 ATGCTGGGCATATTTTAAGGTGG + Intergenic
1154494761 18:14947352-14947374 AAGCTGGGCAGATTTTAATGTGG - Intergenic
1165506582 19:36235046-36235068 AAGATGAGCATTATTTAGCCAGG + Intronic
928441524 2:31296012-31296034 AAGCTAAGGATATATTAGCAGGG + Intergenic
929524056 2:42683175-42683197 AAGCTGACCAGATTTTAACTTGG - Intronic
932654534 2:73598326-73598348 AAGATGAGCAGATTTAAGCCAGG - Intronic
933660321 2:84922428-84922450 AAGATGAGCATATTTTGGCTGGG - Intergenic
937663539 2:124458862-124458884 AAGTTGAAAATATTTTAGCATGG - Intronic
938734283 2:134172334-134172356 ATTCTGAGCATATTTTATGGAGG + Intronic
939819569 2:146939952-146939974 AACATGAGCATATTTTAGGCTGG + Intergenic
939885733 2:147679701-147679723 AGGCTGAGCCAATTTTAGAGTGG - Intergenic
940489142 2:154335009-154335031 ATGCTGAGCATAAGTTAGCTAGG - Intronic
1169100920 20:2948315-2948337 AAGTTGAGAATATTTTATAGTGG - Intronic
1177928877 21:27254605-27254627 AGGCTTAGCATATTTTAGGCCGG + Intergenic
1178816024 21:35930215-35930237 AAGCTTAGCACATTTTCACGTGG + Intronic
1179784245 21:43720468-43720490 AAGCTGAGCAGAGTTGAGCGTGG + Intronic
1179981091 21:44896418-44896440 AAGCTGAGCATGTGTGAGCATGG - Intronic
949152418 3:786002-786024 AAGCACAGCATATTTCAGCATGG - Intergenic
951426355 3:22550639-22550661 AAGTTGGGCATTTTTTAGTGTGG - Intergenic
954612088 3:51949997-51950019 AAGCTGAGCATATGTCAGAGGGG + Intergenic
960213915 3:115006405-115006427 AATATGAGCACATTTTAGAGTGG - Intronic
960374434 3:116881096-116881118 AAGCTGAGCATATTTTAGCGTGG + Intronic
963536705 3:146538526-146538548 AAGCTAAGCATGTTATAGAGAGG - Intronic
967335456 3:188339084-188339106 AGGGTGAGCATATTTTTGAGGGG + Intronic
968862752 4:3185581-3185603 AAGCTTAGACTATTTTAGCTTGG + Intronic
970802349 4:19988619-19988641 AAGCTGAGGATATTTCTGAGCGG + Intergenic
970841464 4:20476263-20476285 AAGCTGTACATATATGAGCGTGG - Intronic
975885820 4:78963535-78963557 AAGCTGAGCCTAATTGAGCCCGG + Intergenic
978125520 4:105130855-105130877 AAGCTGGGCATTTTTTTGGGGGG - Intergenic
992757784 5:79924954-79924976 AAGCTGATCATATTTAATCTTGG + Intergenic
994583693 5:101679366-101679388 AAGCGGAGCATATATGATCGGGG + Intergenic
994999141 5:107104917-107104939 AATCTGAGCACAGTTTAGCTTGG - Intergenic
997911713 5:137880901-137880923 AAGCTGAAAATATTTTAGATAGG - Intronic
998679353 5:144448556-144448578 AAGCCAAGCATATTTTAAAGTGG - Intronic
1007708297 6:43804911-43804933 CAGCTGAGCAGATTTTGGTGGGG + Intergenic
1010830059 6:80516271-80516293 AAGCTGAGCATTTTTTCCCCTGG - Intergenic
1011655561 6:89548669-89548691 AAGCCCAGCATATTATAGAGAGG + Intronic
1016073389 6:139768218-139768240 TACCTGATCATATTTTAGAGTGG + Intergenic
1016811506 6:148265573-148265595 ACGCTGAGCATATTTTTTTGTGG - Intergenic
1018807291 6:167271128-167271150 CAGCTGTGCAGATTTTAGCAAGG + Intergenic
1027694601 7:81394184-81394206 AACCTCAGCATAATTTAGCATGG + Intergenic
1031649810 7:124274723-124274745 AAACTGAGCATAGCTTAGTGCGG + Intergenic
1035441151 7:158901400-158901422 AAGCTGAGCACCATTCAGCGGGG + Intronic
1039410846 8:37353798-37353820 CAGGTGTGCATATTTTAGCTTGG + Intergenic
1041621940 8:59981119-59981141 AAGGTCAGCATTTTTTAGCAAGG - Intergenic
1047855577 8:128906449-128906471 TATCTGAGCATCTTTTAGCATGG + Intergenic
1050884348 9:10744849-10744871 AAACTCAGCATGTTTTAGCTAGG - Intergenic
1053230283 9:36401801-36401823 ATGGTGATCATATTTTAGGGTGG + Intronic
1055127450 9:72735163-72735185 GAGCTGTGCATATTGTAGCACGG + Intronic
1061115600 9:128609074-128609096 AACATGAGCATATCTTACCGTGG - Intronic
1062163469 9:135093042-135093064 CAGCTGAGCATATTCCAGCCAGG + Intronic
1187535268 X:20135828-20135850 TACCTGAGCATACTCTAGCGGGG + Exonic
1187752959 X:22487614-22487636 AAGCTTTGCATATTTTACTGGGG - Intergenic
1189696136 X:43665097-43665119 AAGCTGAGCATGTTGGAGCAAGG - Intronic
1190018534 X:46850759-46850781 ATGCTGAGAATATTTTGGAGGGG - Intronic
1195475318 X:105278495-105278517 AAGCTGAGAATATTCTATCAAGG + Intronic
1195581138 X:106503821-106503843 AATCTCACCATATTTTAGCTGGG - Intergenic
1198247979 X:134849845-134849867 AAGAAGAGCATAATTTAGTGAGG - Intronic