ID: 960375007

View in Genome Browser
Species Human (GRCh38)
Location 3:116890076-116890098
Sequence GTGCAGAAACGGATCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960375007 Original CRISPR GTGCAGAAACGGATCCAGGA AGG (reversed) Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
901333085 1:8425401-8425423 GTGCAGCAAGGGACCCAAGAAGG + Intronic
901690145 1:10967483-10967505 GTGCAGAAAAGGGTGAAGGAGGG - Intronic
901874796 1:12161376-12161398 CTGCAGGAAAGGATGCAGGATGG - Intergenic
903677252 1:25072269-25072291 GGGCAGAGATGGATCAAGGAAGG + Intergenic
907717980 1:56945525-56945547 GTGCAGGAAGAGATCCAGGATGG + Intronic
908095439 1:60732628-60732650 GTGCTGAAGTGCATCCAGGATGG - Intergenic
908600598 1:65735061-65735083 GTGAAGAAAGTGATACAGGAAGG - Intergenic
911166159 1:94726185-94726207 GGACAGAGACGGATCGAGGATGG - Intergenic
911185775 1:94903369-94903391 GAGCAGAAACAGATTCTGGAGGG + Intronic
916667882 1:166983360-166983382 GAGAAAAAAAGGATCCAGGATGG - Intronic
924547509 1:245043715-245043737 GTGCAGGGACGGCCCCAGGAAGG + Intronic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1065320676 10:24506184-24506206 CTGCAGGAACAGATCCAGGTGGG + Intronic
1069519221 10:69105072-69105094 GTACAGAACAGAATCCAGGATGG - Intergenic
1070609716 10:77925436-77925458 GTGCAGGAACGGATACTGGCGGG - Intronic
1070961901 10:80505310-80505332 GTGCAGTTGCGGCTCCAGGAAGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073959379 10:108908986-108909008 ATGCAGCAACGTATCCTGGATGG + Intergenic
1074700898 10:116091457-116091479 TTAGATAAACGGATCCAGGAAGG + Intronic
1075996236 10:126878477-126878499 GTGCAGACAGAGAGCCAGGATGG - Intergenic
1076270441 10:129147915-129147937 GGGCAGGAACAGAACCAGGATGG - Intergenic
1077396571 11:2326660-2326682 GTGCAGCAACAGATGCAGGTGGG - Intergenic
1078608189 11:12796076-12796098 GTGCAGAAACTGGGCCAGGAGGG + Intronic
1079116964 11:17646109-17646131 GCCCAGAAAGGGAGCCAGGATGG - Intronic
1080640471 11:34155538-34155560 CTGAAGAAACGGCTCCAGCAAGG + Intronic
1080660691 11:34293572-34293594 GTGCAGGAACTGTTCCGGGAAGG + Intronic
1083843017 11:65315328-65315350 GTCCTGAAACGGATCCGGGCTGG + Intronic
1085869107 11:80328397-80328419 GGGGAGAAAGGAATCCAGGAAGG - Intergenic
1086061433 11:82703578-82703600 GTGCAGACACTGAGCTAGGAGGG - Intergenic
1090355962 11:126140508-126140530 GTGCAGAAAGGGACACAGAAGGG + Intergenic
1093334638 12:17888297-17888319 GTGCAGATATAGATCCAGAATGG + Intergenic
1097004006 12:55901966-55901988 CTGCAGCAGCGGATCCAGGCTGG - Exonic
1101829522 12:108246510-108246532 GTGCAGAAGGGGAACCTGGATGG - Intronic
1103024228 12:117560410-117560432 GTGCAGAAGGGGAGCAAGGAGGG + Intronic
1110417009 13:75264047-75264069 GTGCAAGAAGGGGTCCAGGATGG + Intergenic
1111693361 13:91592761-91592783 GTGCAGGAAAGCATCCAGGCTGG + Intronic
1113823978 13:113236001-113236023 GTGCAGAACTGGACCCAGTAGGG + Intronic
1114055473 14:18964476-18964498 GTGCAGCAATGGATGCAGGTGGG - Intergenic
1114107072 14:19437287-19437309 GTGCAGCAATGGATGCAGGTGGG + Intergenic
1117973310 14:61273359-61273381 TTGCAGAGAAGTATCCAGGAAGG - Intronic
1120191913 14:81447266-81447288 GCTCAGAAACTGACCCAGGATGG - Intergenic
1121584096 14:95051112-95051134 GTGCAGAGACAGAGCCAGGCAGG - Intergenic
1124358701 15:29018559-29018581 GTGCAGAGCAGGATCCAGGAGGG + Intronic
1132860760 16:2070659-2070681 CTGCAGAGACGGCCCCAGGATGG + Intronic
1132906521 16:2285354-2285376 GTGCAGAACCGGAACCAGCTGGG - Intronic
1133976019 16:10600443-10600465 ATGCAAAAAGGGATCAAGGAAGG - Intergenic
1137547879 16:49416661-49416683 GTGCTGCAATGGAGCCAGGATGG + Intergenic
1140292512 16:73673876-73673898 CTCCAGATACAGATCCAGGAAGG + Intergenic
1141143472 16:81513223-81513245 GAGCAGCAACGGATGCAGGCAGG - Intronic
1142909035 17:3071597-3071619 GGGCAGAACCAGGTCCAGGATGG - Intergenic
1142925527 17:3232645-3232667 GGGCAGAACCAGGTCCAGGATGG + Intergenic
1143887393 17:10075456-10075478 GTGCAGAAAGGAAACCATGATGG - Intronic
1144047384 17:11466137-11466159 GTGCAGACACCCTTCCAGGACGG - Intronic
1144956809 17:19022827-19022849 CTGCAGAATCTCATCCAGGATGG + Intronic
1152128643 17:78462462-78462484 GTGGAGGAAAGGATCCAGGGAGG + Intronic
1154141306 18:11826664-11826686 ATGAGGAAAGGGATCCAGGAGGG + Intronic
1155552214 18:26976531-26976553 GGCCAGACAGGGATCCAGGAGGG + Intronic
1156482552 18:37445328-37445350 GAGCAGAAATGGAGCCTGGAAGG + Intronic
1159619849 18:70624367-70624389 GTCCTGAAACGGATCCTGGGTGG - Intergenic
1161770698 19:6229187-6229209 GTGGAAAAGCGGAGCCAGGAGGG + Intronic
1165094612 19:33403334-33403356 GTCCAGAACCAGAGCCAGGAGGG + Intronic
1165116760 19:33533387-33533409 GTGGAGAAGCTGCTCCAGGACGG + Intergenic
1165142084 19:33705694-33705716 GGGCAGAAAGGGAGCCAGGGTGG - Intronic
1167174187 19:47853972-47853994 GTGGGGAAACTGATCCTGGAGGG + Intergenic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
927045438 2:19273475-19273497 GAGCAGAGGCAGATCCAGGATGG + Intergenic
930765283 2:55079018-55079040 GTCCAGAAAAGGGGCCAGGAAGG + Intronic
931451106 2:62368492-62368514 AAGCAGAGAAGGATCCAGGAAGG + Intergenic
932429830 2:71667627-71667649 GTGAAGAAATGGGTCAAGGAAGG - Intronic
934528450 2:95068343-95068365 ATGAAGAAATGGATCCATGAAGG + Intergenic
934729786 2:96649348-96649370 TGGCAGAAAAGGATGCAGGAGGG - Intergenic
936018654 2:108978235-108978257 AAGCAGAAAAGGATCCAGGCAGG + Intronic
936284542 2:111172096-111172118 TTACAGAAAAGGACCCAGGAAGG + Intergenic
936532456 2:113285927-113285949 GTGCACACTCAGATCCAGGATGG - Intergenic
937274287 2:120674103-120674125 ATGCAGAAAGGCAACCAGGAAGG + Intergenic
937597289 2:123687122-123687144 GTGCAGGAACAGATCCATGGAGG - Intergenic
937816712 2:126258713-126258735 CAGCAAAAACGAATCCAGGAAGG - Intergenic
942877478 2:180818692-180818714 GTGCAAAAACAGATCAAAGAAGG - Intergenic
942900080 2:181105571-181105593 TTGTAGAAACGGATCTACGAGGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
1172835758 20:37872054-37872076 GTGTAGAAACTGATCCTGGGAGG - Exonic
1173198327 20:40934387-40934409 GTGGGGAAAGGGATCCAGGGAGG + Intergenic
1174396668 20:50251030-50251052 ATGCAGAAAAGGGGCCAGGATGG - Intergenic
1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG + Intronic
1180473951 22:15687028-15687050 GTGCAGCAATGGATGCAGGTGGG - Intergenic
1181822107 22:25484399-25484421 GTGCCCACACTGATCCAGGATGG - Intergenic
1183513761 22:38251186-38251208 GTGCAGAAACGTGGCCAGCATGG - Intronic
1185288526 22:50012994-50013016 GTGCAGAGATGGCTCCAGGCCGG + Intergenic
1185414806 22:50704197-50704219 CTGCAGAAACGGGACCACGAGGG + Intergenic
950739010 3:15034788-15034810 CTGCAGAACAGCATCCAGGAAGG + Exonic
954371864 3:50173141-50173163 GAGCTGAGAAGGATCCAGGAAGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959664640 3:108906962-108906984 GTGCAGAAACGGAGGCAAGGAGG - Intergenic
960375007 3:116890076-116890098 GTGCAGAAACGGATCCAGGAAGG - Intronic
964210600 3:154222808-154222830 TTGCAGAAAGGGAGCCAGGAGGG + Intronic
966779235 3:183569415-183569437 GTGCAGAAACAAACACAGGAGGG + Intergenic
968357967 3:198122983-198123005 GTACAGACAGGGGTCCAGGAGGG + Intergenic
971029977 4:22625352-22625374 GGCCAGACAGGGATCCAGGAAGG + Intergenic
973214011 4:47648823-47648845 GGGCAGACACTGGTCCAGGATGG - Intronic
977347381 4:95834249-95834271 GAGCAGAAACGGACTCAGCAAGG - Intergenic
977984891 4:103371605-103371627 ATACAGAAATGCATCCAGGAGGG - Intergenic
978800460 4:112751043-112751065 GTACAGAAACGGAACAAAGAAGG + Intergenic
978912946 4:114086584-114086606 GTACACCAACGGATTCAGGAGGG + Intergenic
985832009 5:2240735-2240757 CTGCAGCAACTGGTCCAGGATGG - Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
989436835 5:41423748-41423770 GAGCAAAAATGGATCCAGGCTGG - Intronic
996337731 5:122403136-122403158 GTGCTGAAACTGAGCCTGGAGGG + Intronic
997413489 5:133707828-133707850 GTGCAGAAAGGGCTCCAGGCAGG - Intergenic
998207211 5:140166438-140166460 GTGCAGACAGGGAGGCAGGAAGG + Intergenic
1000837696 5:166176979-166177001 GGGCACAAACAGATCCAGGCTGG + Intergenic
1001273173 5:170331294-170331316 GTGCGGAACTGGAGCCAGGAAGG - Intergenic
1001398845 5:171434932-171434954 CTTCAGAAAGGGGTCCAGGAAGG + Intronic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1002591491 5:180293649-180293671 GTAGAGGAACGGATCCAGCATGG + Intergenic
1002701291 5:181127072-181127094 GTGGAGAAACGGCAGCAGGAAGG - Intergenic
1003115737 6:3282878-3282900 GGGCAGAGACGGCACCAGGAAGG + Intronic
1007263014 6:40576944-40576966 GTGCAGGAACGGATCATGCATGG - Intronic
1009938507 6:70261395-70261417 ATCCAGAAATGGATCCTGGAAGG + Intronic
1014982713 6:127964390-127964412 GTGCAGCAAAGGCTGCAGGAAGG + Intergenic
1016693066 6:146961674-146961696 GGGCAGAAATGAGTCCAGGAAGG + Intergenic
1027899195 7:84087751-84087773 GTTCAGAAAAGGATTCAAGAAGG - Intronic
1028049037 7:86159257-86159279 GTGCAGAACTGGATGGAGGATGG + Intergenic
1030774640 7:113518949-113518971 GCACAGAAAGGGATTCAGGAAGG - Intergenic
1032192961 7:129774902-129774924 GAGCAGAGACAGATCCACGAGGG - Intergenic
1032709413 7:134449143-134449165 GTGCAGAAACGAACCCAGAAAGG + Intronic
1032748572 7:134812985-134813007 GGGCAGAAAGAGAACCAGGAGGG + Intronic
1033866776 7:145698609-145698631 AAGCATAAACGGATCAAGGACGG + Intergenic
1034563911 7:151898673-151898695 CTGCTGAGAAGGATCCAGGAGGG - Intergenic
1034698426 7:153075462-153075484 GTGTTAAAATGGATCCAGGAAGG + Intergenic
1035102606 7:156414038-156414060 GTGCAGCAATGCATCCATGATGG + Intergenic
1035234748 7:157489037-157489059 GTGAAGACACAGACCCAGGAGGG + Intergenic
1035765843 8:2104763-2104785 GTGCGGAAACGGACCCAGCATGG + Intronic
1035895163 8:3392057-3392079 GAGAACAAATGGATCCAGGAAGG + Intronic
1039864066 8:41485760-41485782 GGGCCGAAAATGATCCAGGATGG + Intergenic
1048340882 8:133537596-133537618 CTGGAGAAAAGCATCCAGGAGGG + Intronic
1049278815 8:141733579-141733601 GTGCAGACATGGAGCCAGCATGG - Intergenic
1049358372 8:142199873-142199895 GTGCAGAAACGGATGAGGGCGGG - Intergenic
1049483890 8:142841350-142841372 GTGCAGAAACGCACTCAGGATGG - Intronic
1049932629 9:471261-471283 GTGCAGGAAGGGACCGAGGAGGG + Intronic
1051008109 9:12374106-12374128 GTGCAGAAACAGCTGCAGGCAGG + Intergenic
1055350960 9:75387746-75387768 GTGCAGCAAAGGATCCAGGAGGG + Intergenic
1059964853 9:119603529-119603551 GTACAGAGATGAATCCAGGAGGG - Intergenic
1185703960 X:2252722-2252744 GTGAAGAAATGAATCCAAGAGGG + Intronic
1186479314 X:9883944-9883966 TTGCAGATACCGGTCCAGGATGG - Intronic
1186612133 X:11148048-11148070 GTGGAGAAATGGGCCCAGGAGGG + Intronic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1188873711 X:35404581-35404603 GTGCAGAAAGGGATCTACAATGG + Intergenic
1194082895 X:89490109-89490131 GTGCAGAAACGGGTCCCTCATGG - Intergenic
1196245665 X:113396357-113396379 GAGGAGCAACGGATCCAGCAAGG - Intergenic
1198122290 X:133606148-133606170 GTGAAGAAGCCGACCCAGGATGG + Intronic
1200103294 X:153699128-153699150 GAACAGAAGCTGATCCAGGAAGG + Intergenic
1200435546 Y:3145981-3146003 GTGCAGAAACGGGTCCCTCATGG - Intergenic