ID: 960383507

View in Genome Browser
Species Human (GRCh38)
Location 3:116992538-116992560
Sequence CTGGAGGCCTAGAGTGCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960383507 Original CRISPR CTGGAGGCCTAGAGTGCTTA GGG (reversed) Intronic
905583574 1:39100473-39100495 CTGGAAGGCTAGAGTATTTAAGG - Intronic
905628840 1:39507431-39507453 CTAGAGGCCTCGAGCGCTTTTGG + Intronic
906144748 1:43553250-43553272 CTAGAGGCCCAGAGAGGTTAAGG - Intronic
908751782 1:67430657-67430679 CTGAAGACCTAGAGAGTTTAAGG - Intergenic
910431035 1:87159978-87160000 CTGCAGGCCCAGAGAGTTTAAGG - Intronic
919490400 1:198198461-198198483 CTGCAGGCCCAGAGAGTTTAAGG + Intronic
920854937 1:209654438-209654460 CTGGAGCCCTGGAGTTCTTGGGG - Intergenic
924533407 1:244912942-244912964 CTGAAGGCTTCGAGTGCTTCAGG + Intergenic
1065513876 10:26506025-26506047 GGGCAGGCCTAGAGTGCTTAAGG - Intronic
1066824302 10:39545528-39545550 CTTGAGGCCTATAGTGATAAAGG + Intergenic
1071494916 10:86161592-86161614 CTGTAGGCCATGAGTGCTTGAGG + Intronic
1073025193 10:100482560-100482582 CCGAAGGCCGAGAGTGCCTAAGG + Exonic
1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG + Intergenic
1076086206 10:127634423-127634445 CTGCAGGGGTAGAGTGCTTATGG - Intergenic
1076715971 10:132363875-132363897 CTGGAGGCTGACAGTGTTTAGGG + Intronic
1079818589 11:25094716-25094738 CTTGAGGCCCAGGGTGCTGAGGG + Intergenic
1082408145 11:52337076-52337098 TTTGAGGCCTAGAGTACTAAAGG + Intergenic
1083736402 11:64683957-64683979 CTTGAGTCCTAGGGTGTTTAAGG + Intronic
1083737657 11:64690802-64690824 CTGGGGGCCTCCAGTGCTGAGGG - Intronic
1084029498 11:66473072-66473094 CTGGGAGCCTAGAGGGCCTATGG + Intronic
1084208229 11:67608356-67608378 CAGGAGGCCCAGAGTGCTCTGGG - Intronic
1087765891 11:102152901-102152923 GTGGAGGCTGAGAGAGCTTAGGG + Intronic
1091406174 12:210880-210902 CTGGAGGTCTAGGGAGCTTTGGG - Intronic
1093416633 12:18927976-18927998 CTGCTGGCCTAGAGGGTTTAGGG - Intergenic
1098552683 12:71780964-71780986 CTGGACACCCAGAGTGCTAAAGG - Intronic
1098970922 12:76856177-76856199 CTGAAGGCCTTGAGAGCCTATGG - Intergenic
1100620844 12:96271182-96271204 ATTGAAGCCTAGAGTGATTAAGG + Intergenic
1105614672 13:22000972-22000994 GTGGAGTGCTGGAGTGCTTATGG + Intergenic
1108429036 13:50335473-50335495 CTGGAGGGCTGGAGTGCAAATGG + Intronic
1109776483 13:67047872-67047894 CTGGTAGCGTAGAGTGCTTTTGG - Intronic
1110451653 13:75643171-75643193 CTGGATGCCGAGAGTGCTTTGGG + Intronic
1112565044 13:100545454-100545476 CTGGGGCCCTGGAGTGCTTGGGG - Intronic
1112886163 13:104174818-104174840 CTGGAGGCCAAAGGAGCTTATGG + Intergenic
1118063780 14:62168434-62168456 CTGCAGGCTTAGAGAGTTTACGG + Intergenic
1118699759 14:68421758-68421780 GTGGAGGCATGGAGTGCTTTGGG - Intronic
1118870511 14:69737300-69737322 CTGGAGGCAAAGAGTGCCTTAGG + Intronic
1118989019 14:70781303-70781325 CTGGAGGCCAGGACTGCTGATGG - Intronic
1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG + Intergenic
1125965766 15:43874446-43874468 TTCTAGGCCTAGAGTCCTTACGG - Exonic
1128830991 15:70768551-70768573 CTGATGGCCCTGAGTGCTTATGG + Intergenic
1133052411 16:3124618-3124640 CTGCAGTCCTAGAGAGCATACGG + Intergenic
1134211855 16:12284280-12284302 CTTGAGGCTTAGAGAGGTTAGGG - Intronic
1135191844 16:20360778-20360800 CTGGAGGCTAAGAGAGGTTAGGG - Intronic
1135989733 16:27210640-27210662 CTGGATGGCTAGTGTGCTTGGGG - Intronic
1137723451 16:50641346-50641368 CTGGAGGCTTAGAGTGGGCAGGG - Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1139664571 16:68447315-68447337 CTGGAGCTCTTGAGTGCTTGAGG + Intronic
1142285411 16:89169623-89169645 CTGGAGGCTTGGGGTGCTGAGGG + Intergenic
1143544016 17:7585972-7585994 CTGGGAGCCAAGAGTGCTGAAGG + Exonic
1143725063 17:8838991-8839013 CTGCAGGCCTGGAGTGCTGAGGG + Intronic
1147602502 17:41755043-41755065 CTGGAGGCCCTGGGGGCTTAGGG + Exonic
1154411714 18:14145366-14145388 CTGGAGGCCTAGAGGCCCTCAGG - Intergenic
1156764219 18:40631845-40631867 CTGGAGATCTAGAGCACTTATGG + Intergenic
1158305158 18:56097266-56097288 TTTGAGGCTTAGATTGCTTAAGG + Intergenic
1159557600 18:69961730-69961752 CTTGAGGTCTGGAGTCCTTAAGG - Intronic
1168361593 19:55745379-55745401 CTGAAGGTCTGGAGTGCATAAGG - Intergenic
928122448 2:28592718-28592740 CTGGGGCCCAAGAGTCCTTACGG - Exonic
928244980 2:29619300-29619322 AAGGAGGCCTAGAGAGGTTAAGG - Intronic
928252119 2:29690177-29690199 CTGGAGCCCTGGAGTGGCTAAGG - Intronic
930827622 2:55710243-55710265 ATGGAGTCCTGGACTGCTTAAGG - Intergenic
931717372 2:65039786-65039808 CTGTAGGCCTAGGGTGGTAATGG - Intergenic
932068590 2:68592664-68592686 CAGGAAAACTAGAGTGCTTATGG + Intronic
933262734 2:80148453-80148475 CTGCAGGCCTAGAGGCCTTTAGG - Intronic
933730306 2:85451269-85451291 CTGGAGGCCTGGTGTCATTATGG - Intergenic
934751958 2:96799419-96799441 CTGGAGCCCTGGAGAGCTCAGGG - Intronic
939245823 2:139622243-139622265 CTCCAGGCCTAGTGTGCTTTTGG + Intergenic
941055499 2:160783396-160783418 CTGCAGGCCCAGAGGGTTTAGGG - Intergenic
941461699 2:165779877-165779899 GTGGACTCCTAGAATGCTTAAGG - Intronic
945279473 2:208022578-208022600 CTGGAGGCCTAGAGTTGCTGAGG - Intronic
945457107 2:210063292-210063314 CTGCAGGGGTAGAGTGCTCATGG + Intronic
947546740 2:231015678-231015700 CTGCAGGCCGAGGGTGCCTAGGG - Intronic
947753708 2:232545880-232545902 CTGGAGTCCGAGAGTGGTTGGGG + Exonic
948776760 2:240293224-240293246 CTGGAGGCCTGCAGTGCCCAGGG + Intergenic
1170155727 20:13267560-13267582 CTCGAGTCCTAGAGAGTTTAAGG + Intronic
1173537301 20:43825394-43825416 CTGTAGCCCTAGAGTTATTAGGG + Intergenic
1174311786 20:49661713-49661735 CTGGAGGCCAAGTATGCATAAGG + Intronic
1178108848 21:29350596-29350618 GTGGAGGCGTAGAGTGCTAGTGG + Intronic
1182675409 22:32035496-32035518 ATGGAGGCCCAGAGAGCTTCAGG + Intergenic
1184103823 22:42355758-42355780 CTGGAGGCCTAGAGACCTGGAGG + Intergenic
950588566 3:13917042-13917064 TTGGAGGCCTAGAGGGTTGAGGG + Intergenic
958203391 3:90353359-90353381 CTTGAGGCCTATAGTGGTAAAGG - Intergenic
960383507 3:116992538-116992560 CTGGAGGCCTAGAGTGCTTAGGG - Intronic
961133884 3:124492725-124492747 TTGGAGGCCTAGAGTGCCACAGG - Exonic
965181027 3:165404086-165404108 CTTGTGGCCTAGACTGCTTTTGG - Intergenic
965273745 3:166653578-166653600 CTCGATGCCTGGAGTGGTTATGG + Intergenic
966984722 3:185168707-185168729 CTGGAGGCACAGAGAGGTTAAGG + Intergenic
967262361 3:187655398-187655420 CTGGAAGCATAAAATGCTTATGG + Intergenic
967873892 3:194253219-194253241 CTGGGGATCTAGAGTGCTGAAGG + Intergenic
976103312 4:81588919-81588941 TTGGAGCCCTAGGGTGCTAAAGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
987981200 5:25086505-25086527 CTGTAGGCCTAAATTCCTTATGG - Intergenic
992108244 5:73468376-73468398 CTGAAGACCTGGAGTGCTGATGG + Intergenic
997544396 5:134693775-134693797 CTGGAGACCCAGAGTGCCTTGGG + Exonic
998937901 5:147250216-147250238 TTGGAGGCATACAGTGATTATGG + Intronic
999896888 5:156044060-156044082 CTGAAAGCATAGGGTGCTTAGGG - Intronic
1003608075 6:7583635-7583657 CTGGAAGCCCAGATTGCTTCAGG + Exonic
1006725873 6:36198342-36198364 ATGGAGGCATAGAGAGCTTAAGG + Intronic
1006789633 6:36691288-36691310 CTGCAGGCCTAGAAGGCTCAAGG + Intergenic
1007221774 6:40284395-40284417 GAGGAGGCCTAGAGGGCCTATGG - Intergenic
1009985375 6:70776127-70776149 CAGGAGTACTAGAGTACTTAAGG + Intronic
1010803194 6:80201944-80201966 ATGGAGAGCTAGAGTCCTTATGG + Intronic
1023370593 7:39508847-39508869 CTGGAGGGCGAGAGTTCTGAGGG - Intergenic
1027052753 7:75030095-75030117 CTGGTGGCCGAGAGAGCTTGTGG + Intronic
1030133190 7:106220449-106220471 GTAAAGGCCTAGAGTGCTTCTGG - Intergenic
1033302411 7:140198340-140198362 CTGGATGCCCACAGTGCCTATGG + Intergenic
1035111363 7:156484918-156484940 ATGGAGGCCTAGAGAGATCAAGG - Intergenic
1035656012 8:1305655-1305677 ATGGAGGCCTGCAGTGTTTATGG - Intergenic
1038531157 8:28318837-28318859 CTGAAGGCTGAGAGTACTTACGG + Intronic
1040984704 8:53280866-53280888 CTGGAGGGCTAGATGGCGTAGGG + Intergenic
1045121228 8:99038101-99038123 AGACAGGCCTAGAGTGCTTAAGG + Intronic
1052975053 9:34403958-34403980 CTAGAGGCCTGGAGTGGTAATGG - Intronic
1055555561 9:77470122-77470144 CTGGAGGCGGAGAATGCTCACGG + Intronic
1057859834 9:98632241-98632263 CTGGAGGCTTAGAGAGGTTAAGG - Intronic
1059336885 9:113574711-113574733 CTTGAGGGATAGAGAGCTTAGGG + Intronic
1059677993 9:116558474-116558496 CTGGGGACCAAGAGAGCTTATGG + Intronic
1059688440 9:116660437-116660459 ATGGAGGCTTAGAGAGGTTAAGG - Intronic
1060413891 9:123417469-123417491 CAGGAGGCCCAGAGAGGTTAAGG + Intronic
1062030779 9:134360984-134361006 CAGGAGGCCTGGAGAGCTTTTGG + Intronic
1186730573 X:12405187-12405209 CTGGAGGCAAAGAGTTCATAAGG + Intronic
1187115723 X:16348281-16348303 CTGGGGGCCTGGAGAGCTTTGGG + Intergenic
1189019509 X:37319899-37319921 CTTGTGGCCTAGAGTGCCTTCGG - Intergenic
1189712316 X:43826280-43826302 CTGTAGGACTAGAGTGCTTGTGG + Intronic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic
1201608389 Y:15813150-15813172 CTGGAGAGCTAGAGTGGATATGG + Intergenic
1201741476 Y:17328397-17328419 CTGGAGGCATTGAGTTTTTAAGG + Intergenic
1201911881 Y:19141086-19141108 CAGGAGGCCTTGAGTCCTGAAGG - Intergenic