ID: 960390853

View in Genome Browser
Species Human (GRCh38)
Location 3:117075923-117075945
Sequence CAGGGAAAAAAACATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 637}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960390853_960390857 -3 Left 960390853 3:117075923-117075945 CCATCCTCATGTTTTTTTCCCTG 0: 1
1: 0
2: 3
3: 62
4: 637
Right 960390857 3:117075943-117075965 CTGAAACCACATAGCTGCCAAGG 0: 1
1: 0
2: 1
3: 31
4: 255
960390853_960390860 28 Left 960390853 3:117075923-117075945 CCATCCTCATGTTTTTTTCCCTG 0: 1
1: 0
2: 3
3: 62
4: 637
Right 960390860 3:117075974-117075996 ATTCAACAACTTTGTTCACCTGG 0: 1
1: 0
2: 1
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960390853 Original CRISPR CAGGGAAAAAAACATGAGGA TGG (reversed) Intronic
900103897 1:974137-974159 CAGGGAGGGAAACAGGAGGACGG + Intronic
900702286 1:4055787-4055809 CAGGGAGAGAAACAGGAGGCAGG - Intergenic
901406549 1:9051210-9051232 GAGGGAAAAAAAGAAAAGGAAGG + Intronic
902919062 1:19655880-19655902 CAGGGAAAAGAACAGGTGCAAGG - Intronic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
904192300 1:28755033-28755055 TGGGGAAAAAAAGATGATGAGGG + Intronic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
905034646 1:34909760-34909782 GAGGGAAAAACAAGTGAGGAAGG + Intronic
905935123 1:41817377-41817399 CAGGGAAAAAAGGATGGGGCCGG + Intronic
906170199 1:43718570-43718592 AAGGGAAAAACACATTAGGAAGG - Intronic
906182314 1:43832783-43832805 CTGGGATAATGACATGAGGAGGG - Intronic
906192084 1:43905169-43905191 CAGGAAGAGAAACAGGAGGAGGG - Intronic
906335353 1:44925500-44925522 CGGGGAGAAAAAAATGGGGAGGG + Intronic
907133422 1:52117471-52117493 CAGGGAAAAAACCAGAGGGATGG + Intergenic
907323914 1:53623555-53623577 AAAGGAAAAAAGCATGAAGATGG + Intronic
908912425 1:69087703-69087725 CAAGGAAAGAAAAATGAGAAAGG - Intergenic
908982542 1:69976361-69976383 CAGGCAGAAAAACATGAAAAGGG - Intronic
909164651 1:72204316-72204338 GAGGGAAAAAATGGTGAGGAAGG - Intronic
909972740 1:82009730-82009752 AAGAGAAATAAAAATGAGGATGG - Intergenic
909988819 1:82196225-82196247 TATGGAAACAAAAATGAGGATGG + Intergenic
910402047 1:86847277-86847299 TAGGGGAAAAGAGATGAGGATGG - Intergenic
910524294 1:88160067-88160089 CAGGAAAAAAAATCTGAGGTTGG + Intergenic
910709269 1:90162254-90162276 CAGAGAAACCAACCTGAGGAAGG - Intergenic
911086594 1:93983398-93983420 AAGGGAATATGACATGAGGATGG + Intergenic
912016100 1:105038465-105038487 AAGGAAGAAAAAAATGAGGAGGG - Intergenic
912065075 1:105728387-105728409 CCTGGAAAAGAACATTAGGAAGG + Intergenic
912855357 1:113164313-113164335 CAGGGAAAAAAAAATGTGTGAGG - Intergenic
913103128 1:115587833-115587855 CAGGGAGAAAAACTTAAGAAGGG - Intergenic
913135065 1:115880354-115880376 CAGGGAAAAAAATGTAAGGTTGG - Intergenic
913590951 1:120324080-120324102 CAGGGAAAGGGACATGAGGCAGG + Intergenic
913652417 1:120931023-120931045 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914168691 1:145198027-145198049 CAGGGAAAGGGACATGAGGCAGG + Intergenic
914465055 1:147920188-147920210 AAGGAAAAAAAACATCAGGCTGG + Intergenic
914523812 1:148441986-148442008 CAGGGAAAGGGACATGAGGCAGG + Intergenic
914599862 1:149193862-149193884 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914642593 1:149625154-149625176 CAGGGAAAGGGACATGAGGCAGG - Intergenic
915784775 1:158597591-158597613 CAGGCAAGAAAACATGTGCAGGG + Intergenic
916308309 1:163364705-163364727 CAGGAAAAAAAAAAAAAGGATGG - Intergenic
916919621 1:169450226-169450248 CAGGGAAAAATACATTATCACGG - Intronic
917293884 1:173499063-173499085 CTCAGAAAAAAACAAGAGGACGG + Intergenic
917352379 1:174091475-174091497 CAGAGAAAAAAATATAAGGTTGG - Intergenic
917505716 1:175625185-175625207 AAAGGAAAAAAACATCAGAAAGG - Intronic
917742537 1:177974951-177974973 CAGGGAAAAAGAGGTGAAGATGG + Intronic
918146290 1:181758810-181758832 CAGGGAAAACACCATGGTGAAGG - Exonic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
918619395 1:186584649-186584671 CAGGCAAGAAAGCATGTGGAGGG - Intergenic
918638779 1:186812655-186812677 CACAGAAAGAAAAATGAGGAGGG + Intergenic
919237750 1:194868216-194868238 CAGAGAAAAAAAAAAAAGGAAGG + Intergenic
919256014 1:195126194-195126216 CAGGGAAACTAACCTGAGAATGG + Intergenic
919457851 1:197840984-197841006 AAGTGAAAATAACATGAGAACGG - Intergenic
919604936 1:199669969-199669991 CAGGGACAAGAACCAGAGGAAGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
920824993 1:209416688-209416710 TGGGGAAGAAAACATGAAGAAGG + Intergenic
921688048 1:218113120-218113142 CAAGGAGAAAAACCTGAGCAGGG + Intergenic
922020705 1:221701289-221701311 TAGGGAAAGAGAGATGAGGAAGG - Intergenic
922331806 1:224583535-224583557 TAGGGAAGATAACAAGAGGATGG + Intronic
922824942 1:228511467-228511489 GAGGGAAAGGAAGATGAGGAAGG + Intergenic
923253245 1:232196878-232196900 CAGGCAGAAAAACATGAAAAGGG - Intergenic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924143501 1:241050180-241050202 CAGGATAAAAAACCTGGGGAAGG - Intronic
924148334 1:241100835-241100857 CATGGAAAGAAACATGAAGGTGG - Intronic
924356786 1:243186404-243186426 CCAGGAAATAAACATGATGATGG - Exonic
924813877 1:247426189-247426211 CTTGGAAAAAAACATGATGAAGG + Intronic
1064665564 10:17647497-17647519 AAGGGAAAAAAAAAAGTGGAAGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064889748 10:20157285-20157307 CAGGGAAACAAAAATGAGTTTGG + Intronic
1065920485 10:30388391-30388413 CAGGTAAATAAACATGGGGTGGG - Intergenic
1066214289 10:33270869-33270891 CATGGAAGAAAACATTAGGTTGG + Intronic
1066247547 10:33598048-33598070 CAGGGGAAAAAAATTGAGGCAGG - Intergenic
1066286452 10:33971158-33971180 GGGGGAAAAAAATGTGAGGAAGG - Intergenic
1067257909 10:44661975-44661997 CAGGGAAAGAGACATAAAGATGG - Intergenic
1068016236 10:51519480-51519502 CTTGGAAAAAAACATGAGGGGGG + Intronic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068699536 10:60004963-60004985 CAGGGAAATATATCTGAGGAAGG - Intergenic
1068785497 10:60968084-60968106 CACTGAAGAAAACAAGAGGAAGG - Intronic
1069292935 10:66805577-66805599 GGGGGAGAAAAACATAAGGAAGG + Intronic
1069403785 10:68076688-68076710 CAGGGAAAACAAGGTGAAGAGGG - Intergenic
1069877600 10:71572666-71572688 CAGGGAAAAAATTATAAGAAAGG - Intronic
1070998728 10:80810407-80810429 AATGAAAAAAAACGTGAGGAGGG + Intergenic
1071087075 10:81876215-81876237 GAGGGAAAAAGACAGCAGGAGGG - Intronic
1071538446 10:86455526-86455548 CAGGGACACAAACACAAGGAAGG + Intronic
1071798528 10:89031738-89031760 CAGAGAAAATAACAAGAGCAAGG + Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1073734891 10:106334704-106334726 CAAGGAAAACAACAGCAGGAAGG + Intergenic
1074239484 10:111622694-111622716 AAGGGTATAAAACATCAGGATGG + Intergenic
1075168069 10:120087256-120087278 CAGGGAAAGATAAATGAGAATGG + Intergenic
1075417488 10:122275704-122275726 CAAGGAAAAAAGCACGAGGAGGG - Intronic
1075651046 10:124128512-124128534 CAAGGAAAAAAACAAGATGAGGG - Intergenic
1075948941 10:126460865-126460887 CAGAGAAATAAAAATTAGGAAGG - Intronic
1076066371 10:127451313-127451335 GATGCTAAAAAACATGAGGATGG - Exonic
1076141760 10:128084983-128085005 ACAGGAAAAAAACATGAGCAGGG - Exonic
1076194405 10:128506236-128506258 CACGGAATAAAACAAAAGGAGGG - Intergenic
1076248923 10:128969134-128969156 GAAGGAAAAGAACATCAGGAAGG + Intergenic
1077601820 11:3580024-3580046 CAAACAAAAAAACATGTGGAAGG + Intergenic
1077603421 11:3590004-3590026 GAGGGAGAAAAACATGATGGGGG + Intergenic
1077694073 11:4377606-4377628 CAAGTAAAGAAACATGATGAGGG - Intergenic
1077726824 11:4683105-4683127 CAGGGAAAGTAAAATGAGAAAGG - Intronic
1077741484 11:4850512-4850534 CAGGGAAGAAAATATGACTATGG - Intronic
1078241401 11:9533988-9534010 AAGGGAAAAAAAAAAAAGGAGGG - Intergenic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078841346 11:15078052-15078074 AGGGGAAAAAAAGAAGAGGAGGG - Intronic
1079022099 11:16917580-16917602 AAGGGAAGGAAATATGAGGAGGG - Intronic
1079711384 11:23687050-23687072 CAGCAAAAAAAACAAGAGGGTGG + Intergenic
1079849706 11:25516090-25516112 CAGAGAAAGAAAGAAGAGGAGGG - Intergenic
1079918319 11:26399140-26399162 CAGCGAAAAAAAGGTGAGGTTGG - Intronic
1080241314 11:30129929-30129951 CAGGGATAATAACATGATCAAGG - Intergenic
1080655950 11:34258306-34258328 AAGGGAAAAAAAAATGAAGTGGG - Intronic
1080969223 11:37250063-37250085 AAGGAAAAGAAACATGTGGAAGG + Intergenic
1081251110 11:40835142-40835164 GAGGGAAAGAAATATCAGGATGG - Intronic
1082182433 11:49135847-49135869 CAGGAAAAAAAATATGCAGAAGG + Intergenic
1082796325 11:57380610-57380632 AAGGGAAAGACGCATGAGGAGGG + Intronic
1082957338 11:58884574-58884596 CAGGGAAAAAGTTATGATGATGG + Intronic
1083072150 11:59995788-59995810 CAGGGAGAAAAACATATGCAGGG - Intergenic
1083504850 11:63146816-63146838 CAGAGAAAAAAGCATTAGTAAGG + Intronic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1083516974 11:63269034-63269056 CAGAGAAAAAAGCATTAGTAAGG + Intronic
1083630125 11:64091054-64091076 GAGGGAAGAGAAGATGAGGAGGG + Intronic
1083955215 11:65979081-65979103 CAGGGAGGAAAAAATAAGGAGGG - Exonic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1085309369 11:75507110-75507132 CAGGGAAAGAAAGAGGAGAAGGG + Intronic
1086229825 11:84555015-84555037 GAGTGAAGCAAACATGAGGAAGG + Intronic
1086234406 11:84610667-84610689 CAGGGAAGGAAAAGTGAGGAGGG - Intronic
1086322617 11:85666044-85666066 AAAGGAAAAAAAAATGAGGATGG - Intronic
1086531960 11:87797132-87797154 CATGGAATAAAAAATGATGAAGG + Intergenic
1087431534 11:98062346-98062368 CAGGGCAAAAGACCTGAAGAAGG - Intergenic
1087523347 11:99273089-99273111 CACGGAAAGAAAAATGAGTAAGG + Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088113624 11:106291408-106291430 CAGGCAGAAAAAAAAGAGGATGG - Intergenic
1089232261 11:116989189-116989211 CGGGGAAAAAAAAAAGTGGAAGG - Intronic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089646316 11:119881943-119881965 TAGGCAAAAAAAAATGAGCATGG - Intergenic
1089910230 11:122091437-122091459 CAGAGGAATACACATGAGGAAGG + Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1089965888 11:122655079-122655101 AAGGGAAAAAGAAAGGAGGAAGG - Intergenic
1090440209 11:126719038-126719060 GAGGAAAACAAACATGAGAAAGG - Intronic
1090522446 11:127493798-127493820 CAGGGAGAAAAACATTAAAACGG + Intergenic
1091058543 11:132441023-132441045 CAGGGAGAAACAGATGAGGGAGG + Intronic
1091095203 11:132814488-132814510 CAGAAATGAAAACATGAGGAAGG + Intronic
1091142781 11:133250367-133250389 CAGCCAAAAAGAAATGAGGAAGG + Intronic
1091592242 12:1850555-1850577 CAGAAATAAAAACATGAGCAAGG - Intronic
1092684092 12:11021852-11021874 AATGGCAAATAACATGAGGAAGG + Exonic
1092944737 12:13442195-13442217 CAGGGAAAGAGAGATGAGGAGGG - Intergenic
1093171656 12:15867897-15867919 CAGGGAAAAAAACATGATACAGG + Intronic
1093278500 12:17159855-17159877 AAGGGAAGAAAATAAGAGGAAGG - Intergenic
1094034627 12:26054695-26054717 AAGGGAAAAAAATATTAGGAAGG + Intronic
1094116610 12:26921370-26921392 CAGGCAAACAACCTTGAGGAAGG - Intronic
1094267340 12:28574100-28574122 TAGGGATAAAAACTTGAGGAAGG + Intronic
1094761778 12:33541392-33541414 CAGGGAATAAAATGTGAGGCAGG + Intergenic
1094859868 12:34451666-34451688 CCGGGATAAAAAGTTGAGGAAGG - Intergenic
1095237728 12:39818273-39818295 CAGGAAAAAAAAAATGAGTTGGG + Intronic
1095296232 12:40530719-40530741 CAGGGAACAAAACACAAGGAGGG - Intronic
1095391208 12:41708768-41708790 CAGGAATAAAAACATGCAGAAGG + Intergenic
1096331480 12:50717243-50717265 CAGGGAAAAAAATGTCAGCAAGG - Intronic
1096925747 12:55143693-55143715 GAGGGAAAAAAACAAAAGGAGGG - Intergenic
1097305669 12:58066542-58066564 GAGGCAACATAACATGAGGAGGG - Intergenic
1097309925 12:58107434-58107456 CAAGGAAAAAAAAATGTGGCTGG + Intergenic
1097438161 12:59576389-59576411 GAGGGAAGAAAACTAGAGGAAGG + Intergenic
1097828882 12:64202809-64202831 AAGGGAAAAGAACATGATGTGGG + Intronic
1097987255 12:65797147-65797169 AAGGGAAAAAAACATGCAGATGG - Intergenic
1098154176 12:67580057-67580079 CCCCCAAAAAAACATGAGGATGG - Intergenic
1100082887 12:90874638-90874660 CAGGCAGAAAAACATGAAAAGGG + Intergenic
1100307450 12:93364021-93364043 AGGGGAAAAAAAAATGAGGCAGG - Intergenic
1100483539 12:95003280-95003302 CAGGGAAAAAAACTTTACCAGGG + Intronic
1100928976 12:99584759-99584781 CAGGCAACAGAACATGAGCAGGG + Intronic
1101051419 12:100867965-100867987 CTGGGGAAATAACATCAGGATGG + Intronic
1101565616 12:105902186-105902208 CAGGGAAAAGCCCATGAGGTTGG - Intergenic
1101646966 12:106640311-106640333 AAGGAAAAGAAACATCAGGAAGG + Intronic
1101887230 12:108676012-108676034 TAGGGAAAAGAAAATGATGAAGG + Intronic
1102840925 12:116120537-116120559 CAGGGGAAAATACATAAAGAGGG + Intronic
1103041633 12:117700518-117700540 GCAGGAAAAATACATGAGGAAGG - Intronic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1104379858 12:128297973-128297995 CAGGGAAACTAACATGAAGGAGG - Intronic
1105001990 12:132696006-132696028 GAGGAAGAACAACATGAGGAAGG - Exonic
1105269088 13:18854175-18854197 AAGAGAAAGAAAGATGAGGAGGG - Intergenic
1106068152 13:26379132-26379154 AATGGAAAGTAACATGAGGAGGG + Intronic
1106870464 13:34013461-34013483 CGGGTAAAATAATATGAGGAGGG + Intergenic
1106907322 13:34422503-34422525 CATGGAAAAAAACTTTGGGATGG - Intergenic
1107016834 13:35714427-35714449 CTGGGAGAAAAACAGGAGAAAGG + Intergenic
1107100668 13:36587344-36587366 CTAGGAAAAAAAAATGAAGATGG - Intergenic
1107224776 13:38034499-38034521 AAGGGAAAAACACAAGAGAATGG + Intergenic
1107655821 13:42591376-42591398 GAGGGGAAAAATCATGAGGTGGG - Intronic
1108465839 13:50714703-50714725 GAGGGGAAAACACATGAGAAGGG - Intronic
1109256521 13:60089895-60089917 CAGGCAAAAATGCATGTGGATGG + Intronic
1109370031 13:61411863-61411885 GAGGAAACAAAACAAGAGGAGGG + Exonic
1109519346 13:63487328-63487350 CAGGCAGAAAAACATGAAAAGGG + Intergenic
1110110435 13:71738391-71738413 CAGGGAAAAAGAGATCAGGATGG + Intronic
1111020634 13:82444780-82444802 CAAGGAAAAAATCAGGAGGAGGG - Intergenic
1111473558 13:88718045-88718067 CAGAGAAAGAAAGAAGAGGAGGG + Intergenic
1112157553 13:96834027-96834049 AAGAGAAAAAAATATCAGGAAGG + Exonic
1112610817 13:100953011-100953033 CACGGAAAATCATATGAGGATGG - Intergenic
1112961964 13:105137587-105137609 CAGGGAGAAAAAGATTAGAAAGG + Intergenic
1114280007 14:21184980-21185002 CACTTAAAGAAACATGAGGAAGG - Intergenic
1114465922 14:22922671-22922693 AAGGGAAGAAAGCAGGAGGAAGG + Intronic
1114721656 14:24889032-24889054 CAAGAAAAAAATCATGAAGATGG + Intronic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1115811639 14:37115415-37115437 CCAGCAAAAATACATGAGGACGG + Intronic
1115989112 14:39133423-39133445 TAGGGAAAAAAAAATAAAGAGGG - Intronic
1116219002 14:42057465-42057487 CAGGGAAAGAATCTTGAAGAGGG - Intergenic
1116834307 14:49754611-49754633 GAGGCAAAAAAACGTGAGTAGGG - Intergenic
1117011705 14:51477231-51477253 CAAGGAAATGAACATTAGGATGG + Intergenic
1117218022 14:53571913-53571935 AGGGGAAAAAAATATGGGGAGGG + Intergenic
1117493295 14:56274193-56274215 CAGGGAAAAGGACATTAGTAAGG + Intronic
1117523473 14:56574672-56574694 CAAAGAATAAACCATGAGGAAGG + Intronic
1117541104 14:56747373-56747395 AAGGAAAAAAAAAATGAGAAAGG - Intergenic
1118180001 14:63483225-63483247 CAAGGAAAGGAACATGGGGAGGG + Intronic
1118260647 14:64243790-64243812 CAGGGAAAGAACCATCAGAAAGG - Intronic
1118567976 14:67163460-67163482 CAGGAAAAAAAAAATTGGGAAGG + Intronic
1119013448 14:71021780-71021802 AAGTGAAAGAAACATGAGGGTGG - Intronic
1119039974 14:71264727-71264749 AAGGGAAAGAAAGCTGAGGAAGG - Intergenic
1119246145 14:73110179-73110201 CAGGGAAAAAAAAAAAAGGCCGG - Intronic
1119348152 14:73943234-73943256 CAGGGATGAAAAAACGAGGATGG - Intronic
1119693647 14:76695785-76695807 CAGGGAAGAAACCCTGAGGAGGG - Intergenic
1120483382 14:85080781-85080803 CAGGGACAAATACATGAAGTTGG - Intergenic
1120704927 14:87735951-87735973 CAGGGCAACAGACATTAGGAAGG - Intergenic
1120736823 14:88062680-88062702 AAGGGAAAAAAACAACTGGAAGG + Intergenic
1120865043 14:89288887-89288909 CATTGAAAAAAACATGGGGCCGG + Intronic
1121429063 14:93874073-93874095 CAGGGAAGAAGAGATGAAGAGGG - Intergenic
1122255580 14:100473409-100473431 CAGGGAAACAGACGTGGGGAGGG - Intronic
1124154663 15:27215359-27215381 CACTGAAAAGTACATGAGGAGGG - Intronic
1124664314 15:31579172-31579194 CTGAGGAAAAAACATGAGGCAGG + Intronic
1125307437 15:38335386-38335408 CAGGCAAAAAAAGATAATGAGGG + Intronic
1125403670 15:39331199-39331221 GAGAAAGAAAAACATGAGGACGG + Intergenic
1125741310 15:41966639-41966661 GAAGGAACACAACATGAGGAGGG + Intronic
1125994045 15:44139501-44139523 CAGTGAAAAATATATCAGGAAGG + Intronic
1126536385 15:49769986-49770008 TAGGGAAAAATACATAATGAGGG + Intergenic
1126846708 15:52766887-52766909 CAGTGAATAAAACATGGTGATGG + Intronic
1128142710 15:65313459-65313481 CAGGGAAAAGAACATGAAGATGG - Intergenic
1128255082 15:66190466-66190488 CAAGGAAGGAAACAGGAGGAGGG + Intronic
1129064699 15:72891385-72891407 GATGGAAAAAAACATGAAGCAGG + Intergenic
1129109506 15:73329358-73329380 CAGAAAAAAAGACATGTGGAGGG + Intronic
1129337137 15:74859398-74859420 CAGAGCAAAAAACAGGAAGAAGG + Intronic
1129875426 15:78972389-78972411 AAAGAAAAAAAACATGAGGCCGG - Intronic
1130249809 15:82292491-82292513 CAGGCCAGAAAACATAAGGAGGG - Intergenic
1131948344 15:97652459-97652481 CGGGGAAAAAAAAATGAAGCAGG + Intergenic
1134059940 16:11193189-11193211 CAGGGAAGACAAAATGATGATGG - Intergenic
1134321236 16:13166308-13166330 CAGGCAAAAAAGCAAGAGAAAGG - Intronic
1136331789 16:29584252-29584274 CAGGGAAAAAAAAAAAAAGATGG - Intergenic
1137386510 16:48047531-48047553 AAGGGAAAGGAACAGGAGGAAGG + Intergenic
1137466156 16:48711750-48711772 CAGGTAGAATAACATGAGAAGGG + Intergenic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1138142719 16:54582640-54582662 CAGGGAAAAGAACATCAAAAAGG + Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1139480676 16:67228921-67228943 CAGGGAATAAAAGATGGGGAGGG - Intronic
1140114627 16:72030963-72030985 AACAGAAAAAAACATTAGGAAGG - Intergenic
1140235856 16:73158007-73158029 CAGGAAAAAAAAAATGAGACAGG + Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1142004595 16:87683603-87683625 CAAGGAAAAAAAAAAGGGGAGGG - Intronic
1142393639 16:89818480-89818502 CAGAGAGAAAACCATGAAGATGG + Intronic
1142813641 17:2408662-2408684 CAGGGAAAAAAAAATCACAATGG + Intronic
1143770899 17:9168062-9168084 CAGAGAATAAGAAATGAGGATGG + Intronic
1144486137 17:15665936-15665958 CTGAGAAAAGAACATGAGGAGGG - Intronic
1146505224 17:33399126-33399148 CAGGGAAAGAAATATGGGGTTGG + Intronic
1146604539 17:34246909-34246931 CAAGGAAAAAAACACTTGGATGG + Intergenic
1149089944 17:52765550-52765572 CAGAGAAAAAAAAATGCTGATGG + Intergenic
1149157963 17:53655985-53656007 CTGGGAAATAAACATGAGAAAGG - Intergenic
1150041161 17:61863139-61863161 CGGGGCAGAAAACCTGAGGAGGG - Intronic
1150954056 17:69836217-69836239 GAAGGAAGAAAACAGGAGGAAGG - Intergenic
1151081151 17:71330349-71330371 CTAGGAAAAAAGTATGAGGAAGG + Intergenic
1153186153 18:2488915-2488937 AAGTGAAGAAGACATGAGGAGGG - Intergenic
1153272562 18:3337162-3337184 AAGGGAAACAAACACAAGGAAGG + Intergenic
1153682664 18:7515191-7515213 GAGGGAAAAGAAGAAGAGGAAGG - Intergenic
1155780588 18:29827917-29827939 CAGAGAAGAAAACAAGAGTAAGG + Intergenic
1156386396 18:36609125-36609147 CTAAGAAAAAAACAGGAGGAGGG + Intronic
1156483480 18:37450502-37450524 CAAGGGAAAAAACCTGGGGAGGG - Intronic
1156539199 18:37893167-37893189 CAGGAAAAACAACATGATGTTGG + Intergenic
1156542114 18:37924491-37924513 CAGGGAAAAAAACATGGGAAGGG - Intergenic
1157229890 18:45905882-45905904 CAAGCATAAAAAGATGAGGATGG + Intronic
1157526589 18:48387608-48387630 CAGAGAAACTAACATGAAGATGG + Intronic
1158538871 18:58334276-58334298 AAGGGAAAGGAACATGTGGACGG - Intronic
1158939768 18:62396541-62396563 AAGGGAAATAAGCATGGGGAAGG - Intergenic
1159063318 18:63539976-63539998 CAGGGAAAATAACACAAGAAAGG + Intergenic
1159103213 18:63977986-63978008 CAGAGACAGAGACATGAGGACGG - Intronic
1159332717 18:67020298-67020320 AAGGGAAGAAAACAGCAGGATGG - Intergenic
1159501169 18:69272333-69272355 AAGGGAAAACTACATGGGGAGGG - Intergenic
1159547636 18:69859663-69859685 CAAGGTAACAAAAATGAGGAAGG + Exonic
1160134841 18:76263291-76263313 CAGGAAAAAAAATAAAAGGAAGG - Intergenic
1161544821 19:4874060-4874082 CAGGGGAAAAAAGATGAAGCTGG + Intergenic
1162522775 19:11191718-11191740 CAGGGAAAACAAGAAGAGAAAGG + Intronic
1162846637 19:13397817-13397839 AAGGGAAAAGAGCATGAGAAGGG - Intronic
1164108445 19:22131327-22131349 CACTGAAAAGAACATGATGAAGG + Intergenic
1164756221 19:30691742-30691764 CAAAGAAAAAAAAATGGGGAGGG + Intronic
1164867493 19:31616978-31617000 CAGGGATGAAAAGATGAGGATGG - Intergenic
1166160253 19:40947491-40947513 CAGAGAAAAAGACAGGAGTAGGG + Intergenic
1166169139 19:41015125-41015147 CAGAGAAAAAGACAGGAGTAGGG + Intronic
1166423755 19:42657712-42657734 CAGGTATGAAATCATGAGGATGG + Intronic
1166511274 19:43410500-43410522 CATGGAAAAAATTCTGAGGATGG + Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1168258774 19:55181283-55181305 GAAGGAAAAATACATGTGGATGG + Exonic
925287695 2:2726691-2726713 TGGGGAAAAAAGCAAGAGGAGGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926555807 2:14356571-14356593 CAAGGAAAAAAACATGATAATGG + Intergenic
926867279 2:17373651-17373673 GAGAGAAAAAAAGAGGAGGATGG - Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
926962442 2:18373075-18373097 CAAGGAAAAACACAAGAAGAGGG + Intergenic
927983654 2:27392236-27392258 CAGGAACAACAACATGATGAAGG - Intronic
928056661 2:28063008-28063030 GAGGGAAAAGAACATGGGCATGG - Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
929078180 2:38095822-38095844 CATGGGAAGAAACATGAAGACGG + Intronic
929111353 2:38407662-38407684 GAGGAAAAAAAACAGGAGAAAGG - Intergenic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
929370175 2:41213753-41213775 CAGGAAAACAAACATAAAGAGGG + Intergenic
929810875 2:45188401-45188423 GATGGAACAAAACAGGAGGAAGG - Intergenic
931099844 2:58984857-58984879 CAGTGAAAAAAAACTGAAGATGG - Intergenic
931133356 2:59365803-59365825 CAGGTAAAACAACATAAGAAAGG + Intergenic
931588409 2:63854057-63854079 CCAGGAAAAAAACATTAGCAAGG + Intronic
931622903 2:64229046-64229068 CAGGAAAAAAACCATGAGGTAGG - Intergenic
932125921 2:69145523-69145545 CATGGAAAGAAACATCAGGAGGG + Intronic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
932744460 2:74321322-74321344 CAGGAGAAAGAACCTGAGGAAGG + Intronic
933142882 2:78815519-78815541 CATGAAAAATAACATGAGGAAGG - Intergenic
933345401 2:81078725-81078747 CAGGGAAAAAAACATGGAAAGGG - Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933701807 2:85260478-85260500 CAGGAAAAAAAAAATTAGCAGGG + Intronic
933838994 2:86270828-86270850 GAAGGAAAGAAACATGAGAATGG + Intronic
934062647 2:88309724-88309746 CAGGGAAAAAAAAAAAAGAATGG + Intergenic
934273611 2:91562457-91562479 CATGGAAAAAAACATGGCCAGGG + Intergenic
934510950 2:94942644-94942666 CAGAGAGAAAAAAAAGAGGAAGG + Intergenic
935945861 2:108286102-108286124 CAGGGAAAAATCCATGTGGATGG + Intergenic
935971239 2:108533101-108533123 AAGGGAAAAAAACAAAAGTAAGG - Intergenic
936378329 2:111961940-111961962 AAGGGAAAAAAACTTGCTGAGGG - Intronic
936636561 2:114265465-114265487 CAAGAAAAAAAACATGCTGAAGG + Intergenic
937506614 2:122544583-122544605 CAGTGGAAAAAACATGAGCAAGG - Intergenic
938509428 2:131925272-131925294 TAAGGAAAAAAAAATGAGGAAGG + Intergenic
938621558 2:133059932-133059954 CAGAAAAAAAAAAATGAGGGAGG + Intronic
939287209 2:140147545-140147567 AAGGGCACAAAAGATGAGGAGGG + Intergenic
939412135 2:141841522-141841544 CAGAGAATAAAACATCAGGGAGG - Intronic
939646311 2:144703520-144703542 CATTTAAAACAACATGAGGAAGG + Intergenic
941737885 2:169000113-169000135 ATGGGAAAAAGACATGAGTAAGG - Intronic
941739902 2:169024294-169024316 GATGGAAAAATACATGATGATGG - Intronic
941821449 2:169847824-169847846 CAGGGATAAAAACATTTGAAAGG - Intronic
941925437 2:170889627-170889649 CAGGAAAGAAAAGATGAGGCAGG - Intergenic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942233041 2:173877508-173877530 CAAGGAAAAAAACACGAGTCAGG - Intergenic
942483074 2:176410303-176410325 CAGGAAAAAATACATATGGAGGG - Intergenic
943138628 2:183949495-183949517 CAAGGAAAAAAACATGTAGCTGG - Intergenic
943232360 2:185271159-185271181 CAGGCAGAAAAACATGAAAAAGG + Intergenic
943788531 2:191905951-191905973 CCTGGAAAAGAACATGAGGCAGG + Intergenic
944091167 2:195913688-195913710 CAGCAACAAAAACATGTGGATGG - Intronic
944199141 2:197086758-197086780 CAGGGAAAACATCATTAAGATGG + Intronic
944475998 2:200107442-200107464 CAGGAAAAAAAAGAAGAAGAAGG + Intergenic
944981312 2:205123809-205123831 GAGTGAAAAATACATGAGAAGGG + Intronic
945042729 2:205755606-205755628 TAGGGAAAAAAAAAAAAGGAGGG + Intronic
945903369 2:215563434-215563456 CAGGGAGAAATACATGAATATGG - Intergenic
946660944 2:221998706-221998728 ATGGGAAAAAAACATGTGGCTGG + Intergenic
947112861 2:226738298-226738320 GAGGGAAAAAGATATGAGGTTGG - Intronic
947838482 2:233191737-233191759 GAGTGAACAAAGCATGAGGAGGG + Intronic
947873500 2:233453020-233453042 CAAGGAAAAAAGCCTCAGGAGGG - Intronic
948117940 2:235507515-235507537 AAGGGAAGAAACCAGGAGGATGG - Intronic
948568371 2:238900836-238900858 CAGGAAGGAAAACAAGAGGAGGG - Intronic
948876259 2:240831143-240831165 CAGTGAAAAAAACGGGATGAGGG - Intergenic
948951125 2:241252512-241252534 CAAGTAAAACAACATGGGGAGGG - Intronic
1169016778 20:2298764-2298786 CAGACACAAAAATATGAGGAGGG - Intronic
1169792290 20:9424259-9424281 TAGGGAAAAAAACATAAATAAGG + Intronic
1169902201 20:10565034-10565056 AAGGAAAAAAAAAATTAGGAGGG - Intronic
1169945695 20:10985685-10985707 CAGGGAAAAGAAATAGAGGACGG - Intergenic
1170215453 20:13886133-13886155 CAGGGAACAAAACAGGAGTAGGG + Intronic
1171373037 20:24673965-24673987 TTGGGAAACAAAGATGAGGAAGG + Intergenic
1172073285 20:32274721-32274743 CAGGGGAAAAAAAAATAGGAGGG + Intergenic
1172387091 20:34541580-34541602 GAGGGAAAAAAACAAGAGTGTGG - Intergenic
1172583012 20:36063630-36063652 CATGGAAAAAAAAATCAGGCCGG - Intergenic
1172957649 20:38772526-38772548 AAGGGGAAAAAATAGGAGGAGGG - Intergenic
1173177286 20:40773836-40773858 TGGGGAAAACAACAGGAGGAAGG + Intergenic
1173209179 20:41018647-41018669 CAGCAAAAAAGCCATGAGGATGG - Intergenic
1174104919 20:48155287-48155309 CAGGGAAAACAAGAAGAGGGGGG - Intergenic
1174477246 20:50804333-50804355 GAGTGAAAAAAGCATGAGGCCGG - Intronic
1174978312 20:55360972-55360994 CTGTGAAAACAACATGAGAAAGG + Intergenic
1175273990 20:57754904-57754926 GAAGGAAAAAAAAAGGAGGAAGG - Intergenic
1175751816 20:61503930-61503952 CAGGGAGAAGAACATGAGCCAGG + Intronic
1176784052 21:13233290-13233312 TAAGGAAAAAAAAATGAGGAAGG - Intergenic
1177448734 21:21237033-21237055 CAGGGATAAAAACATAAATAAGG - Intronic
1177510482 21:22080507-22080529 CAGAAAAGAAAACATGAGGTTGG + Intergenic
1177982102 21:27927122-27927144 TAAGGAAAAAAAAATGAGGAAGG - Intergenic
1178154926 21:29840880-29840902 CTGGGAAAAAAACATAAACATGG + Intronic
1178752898 21:35321326-35321348 CGAGGAAAAAAAGAGGAGGAAGG - Intronic
1179495917 21:41771237-41771259 CAGGGAAATGAACATGTGCAGGG - Intergenic
1180237628 21:46473454-46473476 CAGGGAAAAAAAAAGGGGGGGGG + Intronic
1180647429 22:17351178-17351200 CAAGAAAAAAAACAATAGGATGG + Intergenic
1181281212 22:21721905-21721927 CATGGAATCAAACATCAGGATGG - Intronic
1181384556 22:22534411-22534433 GAGGGACAAAACCTTGAGGACGG + Intergenic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
950235446 3:11316060-11316082 GAGGGTAAAATACATCAGGAGGG - Intronic
950506877 3:13400476-13400498 CAGGGAGGATAACAGGAGGAAGG + Intronic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
951707880 3:25561997-25562019 CAGGGTAAAAAAGTTGAGCAGGG - Intronic
951942234 3:28092139-28092161 CAGAGGAAAAAACATGTGCATGG + Intergenic
952322881 3:32294684-32294706 CAGGGCAGAAAACAAGAAGACGG - Intronic
952433080 3:33244871-33244893 CTGGGAAAAAAACAAGATGAGGG + Intergenic
952910839 3:38184111-38184133 CAGTGAAAAAAACTTCTGGATGG - Intronic
952976693 3:38702587-38702609 CAGGGAAACAAAGTTAAGGAAGG - Intronic
953942908 3:47117285-47117307 CAAAAAAAAAAACATGAGAAGGG + Intronic
954048912 3:47956804-47956826 CATGGAAAAAATCATCATGAAGG + Intronic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954656139 3:52195350-52195372 AAGGGAAAAGAAGATGGGGAAGG + Intergenic
955319159 3:57961894-57961916 AAAGGAAAAAAACAAGAAGAAGG - Intergenic
955919364 3:63939344-63939366 CAGGGTGAAAGACATGGGGATGG - Intronic
957573169 3:81975052-81975074 AAGAGAAAAAAAAATAAGGATGG - Intergenic
957719240 3:83972268-83972290 CAGGGAAAAAAACACAAAAATGG + Intergenic
957824142 3:85418966-85418988 AGGGGAAAAAAAAATGAGAAGGG + Intronic
958012851 3:87902525-87902547 GAGGGAAAAAAAGATAAAGATGG + Intergenic
958056179 3:88415385-88415407 CAGGGTTAAAACAATGAGGATGG + Intergenic
960390853 3:117075923-117075945 CAGGGAAAAAAACATGAGGATGG - Intronic
960931643 3:122856890-122856912 CAGAAAAAAACACTTGAGGAAGG - Intronic
961110665 3:124280443-124280465 TGGTGAAGAAAACATGAGGAAGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961367006 3:126406509-126406531 CAGGGAAAGAGACATGTGGCCGG - Intronic
961874574 3:130011918-130011940 GAGGGAGAAAAACATGATGGGGG + Intergenic
961972650 3:130986778-130986800 TAGGGAAAAAGACAAGATGAGGG - Intronic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962611102 3:137076889-137076911 ATGGGAGAAAAAAATGAGGAGGG + Intergenic
963726034 3:148922822-148922844 CATAGAAAAAAACAAAAGGATGG + Intergenic
963870066 3:150407301-150407323 CAGTTAAAAAAAAATGGGGATGG - Intergenic
964661445 3:159124447-159124469 TAAGGAAACAACCATGAGGAGGG - Intronic
964729178 3:159846585-159846607 CAGGGAAAAAGATATTAGAATGG + Intronic
964791487 3:160457106-160457128 CAATGAAAAATACATGAGAACGG - Intronic
965365603 3:167795532-167795554 TTGGGAAAGAAATATGAGGAGGG - Intronic
965775358 3:172224528-172224550 TAGGAAAAAAAACAGGAGCAGGG - Intronic
966223917 3:177577783-177577805 AAGGGAAAAATACATGACAAAGG - Intergenic
966379477 3:179329290-179329312 CAGTGAAATAAACACCAGGAAGG - Intronic
969199390 4:5590471-5590493 CAGGGAAGAAAACCTAATGATGG - Intronic
970018840 4:11543917-11543939 CAGGGAAAACAACCAGGGGAAGG - Intergenic
970049757 4:11900398-11900420 CAGGGAAAAAAATGGGAAGAAGG - Intergenic
970069217 4:12137440-12137462 CTGGGAAAAAAATAGGTGGAAGG + Intergenic
970496187 4:16628513-16628535 CAGGCAAAAAAAGTTGAGAAGGG - Intronic
970789088 4:19835325-19835347 CAGGCAAAAAAACTTGTGCAGGG - Intergenic
971072986 4:23115565-23115587 TAAAGAAAAAAACATGAGGGTGG + Intergenic
971291909 4:25350419-25350441 CAGGGGAAAAAAAATTAGGTGGG - Intronic
971335669 4:25721681-25721703 CAGGGAAATTCACAGGAGGAAGG + Intergenic
972005691 4:34101112-34101134 TAGGGAAAAGAACATGAGCGTGG + Intergenic
972705235 4:41535875-41535897 AAGGGAAAAAAAAATGAAGTTGG - Intronic
972990505 4:44817799-44817821 CAGAAAAAAAAAACTGAGGAAGG - Intergenic
973119463 4:46502473-46502495 CAAGAAAAAAAAAAAGAGGATGG + Intergenic
973301678 4:48591914-48591936 CTGAGAAAAAAACATTAAGAAGG - Intronic
973657125 4:53059607-53059629 CAGGAAAAAAAAAAAGAGAAAGG - Intronic
974356450 4:60818946-60818968 CATGGAAAAATAAATGAGGAAGG - Intergenic
974808594 4:66916107-66916129 CAGGGAAGAGAACATGTGCAGGG - Intergenic
974997026 4:69174225-69174247 GAGGGGAAAAAAGATGAGAATGG - Intronic
975041868 4:69755018-69755040 CAGGAAACAAAAAATGAGGTCGG + Intronic
975060421 4:69990398-69990420 CAGAGAATAAAAGATGATGACGG + Intergenic
975248960 4:72154712-72154734 GAGGGCAAAAACCATGAAGAGGG - Intergenic
976574320 4:86651446-86651468 CAGACAAAAAAACATCAGGAAGG - Intronic
976950701 4:90826700-90826722 CAGGGAAAATAACATGTGCGTGG - Intronic
977502852 4:97863238-97863260 CATGTAATAAAACATGATGAAGG + Intronic
977789320 4:101079800-101079822 CAGGGAAAAGAAGAAGAGCAAGG - Intronic
978422189 4:108544431-108544453 CTGGGAGAAGAAAATGAGGAAGG + Intergenic
978966344 4:114746668-114746690 CAGGCAAGAAAACATGTGCAGGG + Intergenic
978992940 4:115108972-115108994 AAGGAAAAAAGACAAGAGGAAGG + Intronic
979003840 4:115262587-115262609 CATGGAAAAAATCAGGAGGCTGG + Intergenic
979245034 4:118493198-118493220 CCAGGAAATAAACATGATGATGG + Intergenic
979792790 4:124806973-124806995 CAGGCAAGAAAACATGGGCAGGG + Intergenic
980241659 4:130185085-130185107 CATTGTAAAAAACATTAGGAAGG + Intergenic
980252018 4:130329334-130329356 CAGGGAAAAAGAAAGTAGGAAGG + Intergenic
982124485 4:152172980-152173002 ATGGAAACAAAACATGAGGATGG + Intergenic
982166311 4:152616846-152616868 GAGGGAAAGAAACATGTGCATGG + Intergenic
982653292 4:158114502-158114524 CATGGAAAAGCACAGGAGGAGGG + Intergenic
983239325 4:165213683-165213705 AAGGGTAAGAAACATTAGGAAGG - Intronic
984067690 4:175069611-175069633 AAAGGAACCAAACATGAGGAGGG - Intergenic
984085588 4:175306771-175306793 TAGGCAAAAGCACATGAGGAAGG + Intergenic
984398141 4:179226789-179226811 CAAGTAAAAAAAAAAGAGGAAGG - Intergenic
984737102 4:183119552-183119574 CAGAGAAGTAAATATGAGGAGGG - Intronic
986085244 5:4438274-4438296 CAGGGAAGAAAAGAAGAAGAAGG + Intergenic
986143613 5:5055387-5055409 CAGGAATAAAAACTTTAGGATGG + Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
986981264 5:13450365-13450387 CAGGGAGAGATACATGGGGAAGG - Intergenic
987385472 5:17325042-17325064 CAGGGAAGAAGACGTGATGATGG + Intergenic
988166216 5:27593016-27593038 TAGGGGCAAAAATATGAGGAAGG - Intergenic
988285347 5:29208441-29208463 AAGGGAAAAAAACGTAAGGCTGG - Intergenic
989270517 5:39527463-39527485 CAGGTAAAAAACGATGAAGAAGG - Intergenic
989844658 5:46126543-46126565 CCAGGAAAAATACAAGAGGAAGG - Intergenic
989852412 5:46230707-46230729 CAGAGTAAAAAACTGGAGGACGG + Intergenic
989984685 5:50684801-50684823 CAGGGAAAGGGACATGAGGCAGG - Intronic
990252907 5:53935056-53935078 CAGGGATAAAAAGAGGAGGGAGG + Intronic
990498077 5:56368574-56368596 CATGGAAAAAAACATTAAAATGG - Intergenic
990788305 5:59448323-59448345 CAGGGAAATGAACATGGAGAAGG - Intronic
991513071 5:67401547-67401569 AAGGAAAAAAAATATGAAGATGG - Intergenic
992534685 5:77687654-77687676 CATGGTACAAAACATGAGAAAGG + Intergenic
993066929 5:83112725-83112747 CAGGCAAAAGAACATGTGCAGGG + Intronic
993243995 5:85428392-85428414 CAGAGAAGAAAATATGAAGAAGG - Intergenic
993755820 5:91728321-91728343 CAAGGAAAGTACCATGAGGATGG + Intergenic
993808707 5:92445792-92445814 AAGGGAAAAACAGAGGAGGAGGG - Intergenic
994372734 5:98985775-98985797 AAGGGAAAAAGAAAGGAGGAAGG + Intergenic
994456149 5:100010684-100010706 CAGGAAAAAAAAAAGGGGGACGG + Intergenic
995429516 5:112058633-112058655 CAGACAAAAAAAAATCAGGAAGG + Intergenic
995696443 5:114883525-114883547 CAGGGAAACAAAAGTGAGGGGGG + Intergenic
995752165 5:115463706-115463728 CAAGAAAATAAGCATGAGGAAGG + Intergenic
995949182 5:117689028-117689050 AATGGAAATAAACATGGGGAAGG + Intergenic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
996491122 5:124098591-124098613 AAAGGACAAAAACAAGAGGAAGG - Intergenic
997771130 5:136555667-136555689 CAGGGAAAACAAGAATAGGAGGG - Intergenic
997861737 5:137423913-137423935 TATGGAAAAAAACATGAAGATGG - Intronic
998231206 5:140362435-140362457 AAGGCAGAAAAACCTGAGGAAGG - Exonic
998779163 5:145637306-145637328 CAGCAAAGAAAACATGAGAAAGG + Intronic
1000009443 5:157217747-157217769 CAGGGAAAACAACAGAAGAAAGG - Intronic
1000584915 5:163085633-163085655 TGGGGAAAGGAACATGAGGAGGG - Intergenic
1001144690 5:169173544-169173566 CTGGGAAAATAATGTGAGGAAGG - Intronic
1001169438 5:169404790-169404812 CTGGGAAAAAAAAATCAAGATGG - Intergenic
1002038868 5:176495910-176495932 AAGAGAAAAAAAAATGATGATGG + Intronic
1002398391 5:178975999-178976021 CAGGGGAGAAAATGTGAGGAAGG - Intergenic
1002537059 5:179881688-179881710 CAGGGAAAAAAACTTGAAAGGGG - Intronic
1002915771 6:1526535-1526557 CAAGGAAAGGACCATGAGGATGG + Intergenic
1003727229 6:8779031-8779053 CAGGTGAAAAAAGATGAGGGGGG - Intergenic
1004218587 6:13725123-13725145 CATGAAAATAAACATGATGAAGG - Intergenic
1004484092 6:16049284-16049306 CAGGGAAAAAAAAATGTGAAAGG - Intergenic
1004543460 6:16573759-16573781 CAGGGACAAAAGCATGAGGAAGG - Intronic
1006176570 6:32125992-32126014 CAGGGAGAAAAAGGTGGGGAGGG - Intronic
1006381748 6:33702402-33702424 GAAGGAAAGAAACATGAAGAAGG + Intronic
1006970240 6:38036274-38036296 CAAGGAAAAAAATCTGAGCAGGG + Intronic
1007554970 6:42758153-42758175 CAGGGAGAAGAAGATGAGGAAGG - Intronic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1008087473 6:47259814-47259836 CCTGGAGAAAAGCATGAGGATGG + Intronic
1008102531 6:47407300-47407322 CAGGAAAAAACAGATGAGGATGG + Intergenic
1009380738 6:63025632-63025654 CTGGAAAAAAAACTAGAGGAGGG + Intergenic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1009814469 6:68713600-68713622 CTGGAAAAATAACATGAGAAAGG - Intronic
1010369809 6:75094752-75094774 GATGGAAAAATACATGACGATGG - Intronic
1010931876 6:81813615-81813637 AAGAGAAAAATACATGAGTAAGG + Intergenic
1011026539 6:82875536-82875558 CAGGCAGAAAAACATGAAGAGGG - Intergenic
1011198298 6:84805333-84805355 TAGGAAAGAAAACATTAGGAAGG - Intergenic
1011955492 6:93019905-93019927 CAGTAAAAAAAGGATGAGGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012360664 6:98375152-98375174 CAGGGAAGAAAACAGAGGGAAGG - Intergenic
1012604886 6:101145493-101145515 AAAGGAAAAAAACAGGAGGATGG - Intergenic
1012869271 6:104655182-104655204 CAGGGACAAAAAAATCAGTAAGG - Intergenic
1012983233 6:105851648-105851670 CAAGGAAATAAACCTGATGATGG + Intergenic
1013529774 6:111008403-111008425 AAGGGAAAAAAAAAAGAGAAAGG - Intronic
1013921184 6:115406238-115406260 AAAGGAAAAAAAAATCAGGATGG - Intergenic
1015014930 6:128400940-128400962 GAGGGAAAGAAAAATGAGCAAGG + Intronic
1015954458 6:138585599-138585621 CAGTGAAACAAACTTTAGGATGG - Intronic
1016095748 6:140034424-140034446 CAGAGAAAATATCATGAGGTAGG + Intergenic
1016494473 6:144644587-144644609 CAGGGAAAAAAATATAAAGTAGG - Intronic
1016517437 6:144910516-144910538 CAGGGAAAAAAATATGATTGGGG + Intergenic
1016819572 6:148334811-148334833 CAGGGAAAAAAAAATTAGCCAGG + Intronic
1018036915 6:159889531-159889553 CACGGAAGAAAACATGATTAGGG - Intergenic
1018170184 6:161138197-161138219 AAGGGAAAAAAATAAGAGGTTGG - Intronic
1018247049 6:161833497-161833519 CAGGGAAAAAAAAATGCTAATGG - Intronic
1019797010 7:3057763-3057785 GAGGGAGGAAAACAGGAGGAAGG + Intergenic
1019874964 7:3801817-3801839 CAGGGAGAACCACATGAAGACGG - Intronic
1020446293 7:8272164-8272186 CAGGGAAAGAACCATCAGAAAGG - Intergenic
1020667229 7:11061824-11061846 GAGGAAGAAAAACATGAGGTTGG + Exonic
1020669477 7:11088939-11088961 AAGGGAACAAAAAATGAGCATGG + Intronic
1020678448 7:11207485-11207507 CAGGAAAACAAACAGGAAGAAGG + Intergenic
1020846805 7:13295746-13295768 CAGGGAAAAATACTTGAGAAGGG - Intergenic
1020904264 7:14045390-14045412 AAGGGAAAATAACTTGAGCATGG - Intergenic
1020972473 7:14962996-14963018 AAGGGAAACAAATATGAGAACGG - Intronic
1021479111 7:21096109-21096131 CAGAGATAAAAACATCATGAAGG - Intergenic
1021641963 7:22746630-22746652 CATGGGAAAAACCATCAGGAGGG + Intergenic
1021674119 7:23063281-23063303 CAGGGAAAAAAAGATCTGGCTGG - Intergenic
1022310313 7:29190931-29190953 CAGGGAAAAAAAAAAAAGCATGG - Intronic
1022368559 7:29749418-29749440 AAGAAAAAAAAACAGGAGGAAGG - Intergenic
1022724839 7:32971780-32971802 CATGAAATTAAACATGAGGAGGG - Intronic
1023179674 7:37469446-37469468 CAGGCAAGAAAACATGTGTAGGG - Intergenic
1024133795 7:46386023-46386045 CATGGAATAAAACATCAAGATGG + Intergenic
1024425916 7:49226459-49226481 AAGGGAAAAATACATGGAGAAGG + Intergenic
1024487323 7:49932892-49932914 CAGGCAAGAGAACATGAGCAGGG - Intronic
1024525288 7:50343236-50343258 AAGGGAAAGAAAAAGGAGGAAGG - Intronic
1024620609 7:51154233-51154255 CAGAGGAAAAACCATGAGGGTGG + Intronic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024684795 7:51733711-51733733 CAGGGAAGAGAGCATGTGGAGGG + Intergenic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1024884788 7:54128193-54128215 CAGGCAGAAAAACATGAAAAGGG - Intergenic
1025048762 7:55716047-55716069 CATGAAATTAAACATGAGGAGGG + Intergenic
1025095033 7:56090083-56090105 CAAACAAAAAAACATGAGGAAGG - Intronic
1025106849 7:56178110-56178132 CAGGAATAACATCATGAGGAAGG - Intergenic
1025530414 7:61874267-61874289 CAGGATAAAAAACAGAAGGAAGG - Intergenic
1026020731 7:66703463-66703485 CAGGTAAAGATACATGAGGTGGG + Intronic
1026076712 7:67178168-67178190 CAGAAAAAAAAACAGGAGGTGGG + Intronic
1026223674 7:68422360-68422382 CAGGCTAAAAAAGATGAGGAAGG - Intergenic
1026242165 7:68585647-68585669 CAGGAAGCAAAACAAGAGGACGG + Intergenic
1026311420 7:69188094-69188116 CAGGAATAATATCATGAGGAAGG + Intergenic
1026635590 7:72078963-72078985 CAGGGAGACAAAGATGAGAAAGG + Intronic
1026865272 7:73820285-73820307 CGGGGAGAATAACATGAGTATGG - Intronic
1027504154 7:78994459-78994481 CAGGGAAAAAATCATGAAAATGG - Intronic
1027865519 7:83640960-83640982 AAGGAAGAAAAACAAGAGGAAGG + Intronic
1029805991 7:102996746-102996768 CTGGTAAAAGAACATGAGGCTGG + Intronic
1029935647 7:104421673-104421695 CAGAAACAATAACATGAGGAAGG + Intronic
1030135228 7:106240221-106240243 CAGGCAAAAAAACAACAGGTGGG - Intergenic
1030579440 7:111334857-111334879 CACAGAAAAAAACAAGAGAAAGG + Intronic
1030953479 7:115821503-115821525 CAAGAAAAGAAACATGAGCAAGG + Intergenic
1031023674 7:116656277-116656299 TAGGAAAAACAACCTGAGGATGG - Intergenic
1031131521 7:117838360-117838382 CATGGCACAAAACATGAGCATGG + Intronic
1031407247 7:121400681-121400703 CAGGGAAGAAAACATTTGTAGGG + Intergenic
1031429142 7:121644776-121644798 TTGAGAAAAAATCATGAGGAAGG + Intergenic
1031441530 7:121800531-121800553 CAGGCAAAAAGACATAAAGAGGG - Intergenic
1031536016 7:122933848-122933870 GAGAGAAAAAAACTAGAGGAAGG - Intergenic
1032171030 7:129584744-129584766 CCTGGAAAAAAAGATGAGAAGGG + Intergenic
1032839113 7:135700156-135700178 CAAGGAGAAAAGAATGAGGAAGG - Intronic
1033075733 7:138248693-138248715 AAGAGAAAAAAAGAAGAGGAGGG + Intergenic
1033240415 7:139674517-139674539 CAGGAAGAAAGGCATGAGGATGG + Intronic
1033551491 7:142451874-142451896 CAGGAGAGAAAACATGAGGGTGG - Intergenic
1033679675 7:143582169-143582191 CAGAGAAATGAACATGAGGAGGG - Intergenic
1033692160 7:143747274-143747296 CAGAGAAATGAACATGAGGAGGG + Intergenic
1033730735 7:144176368-144176390 AAGGGATAAACACATGTGGAAGG + Intergenic
1034738003 7:153446804-153446826 CAGGGAATAAAACAGAAGGAAGG - Intergenic
1034861892 7:154603101-154603123 AAAGGAAAAAAAGATGAGAATGG - Intronic
1034987809 7:155528149-155528171 CAGGAAAAAGGACATGAGAAGGG + Intronic
1035278568 7:157763284-157763306 AAGGGAGAGAAAAATGAGGAGGG - Intronic
1035557834 8:579670-579692 CAGGGACTGAGACATGAGGAGGG - Intergenic
1035645047 8:1212297-1212319 AAGGGAAGAAAACATTAGGAAGG + Intergenic
1036782272 8:11657981-11658003 CAGGCAGGTAAACATGAGGATGG + Intergenic
1037218122 8:16483412-16483434 GTGAGAAAAACACATGAGGAGGG + Intronic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1038255481 8:25947279-25947301 CAGGGAAGAAAGCATGTGCAGGG - Intronic
1038666804 8:29544475-29544497 CAGGGAGAAGAAGATAAGGATGG - Intergenic
1038687599 8:29732718-29732740 CAGGGAAACAAAGATGAATAAGG - Intergenic
1039087212 8:33791857-33791879 CTGGGAAAAAAACAAGAACAGGG + Intergenic
1039250533 8:35659414-35659436 CATGGAAACAAACATGAACAAGG + Intronic
1040895595 8:52365160-52365182 CATGCACAAAAACATGATGATGG + Intronic
1041153306 8:54958174-54958196 CAGGGAAAAAGTCATGTGCAGGG - Intergenic
1041623265 8:59998419-59998441 TAGTGAAAAAAAGATGAGGAAGG + Intergenic
1041646019 8:60253511-60253533 ATGGGAAAAAAAGATGTGGATGG - Intronic
1041782713 8:61595713-61595735 CAGGGAAATAAAAATAAGAATGG + Intronic
1042187205 8:66148746-66148768 CATAGAAAAAAACATGATTAAGG + Intronic
1042296747 8:67227370-67227392 CAGGGAGAAAAACAGAAGAAAGG - Intronic
1042695840 8:71554583-71554605 CAGGGAAAAAAAAATGCCGAGGG - Intronic
1042927976 8:73986220-73986242 AAGGGAAAAAAAAATGAAAATGG - Intergenic
1043316100 8:78924162-78924184 TAGGTAAAAGAACATGAGGCAGG - Intergenic
1043324073 8:79027994-79028016 CAGGAAGAAAAAGATTAGGATGG + Intergenic
1043441256 8:80278914-80278936 CAGGAAAAAACACTTGAAGAGGG + Intergenic
1043638262 8:82414076-82414098 CAGGCAAGAAAGCATGAGCAGGG + Intergenic
1045344640 8:101283086-101283108 CAGGCCAGAAAAAATGAGGAAGG - Intergenic
1045850605 8:106693334-106693356 CAGGGAAAAACAAAACAGGAAGG + Intronic
1045958765 8:107941853-107941875 AAAGGAAAAAAACATGAAAAGGG + Intronic
1046566937 8:115914004-115914026 CAGGGAAGAAAATCTGAGGTAGG - Intergenic
1047353945 8:124102503-124102525 CATGGGCAAAAACATGAGAATGG - Intronic
1047662218 8:127049737-127049759 TAGGGAAAAAAATATGTAGATGG - Intergenic
1047680612 8:127250619-127250641 CAGAGAAATAAACATGATGTGGG + Intergenic
1047821376 8:128525013-128525035 CTGGGAAAAATACCTTAGGAAGG + Intergenic
1047836730 8:128701886-128701908 CAGGCAGAAAAACATGACAAGGG - Intergenic
1048054123 8:130847162-130847184 GAGGGAGAAAGAAATGAGGAAGG + Intronic
1048297282 8:133223616-133223638 GAGAGAAAGAAACAGGAGGAAGG - Intronic
1048531403 8:135253523-135253545 TAGGGAAAGAAAGAAGAGGAGGG + Intergenic
1048676404 8:136787705-136787727 CAGGCAAATAAACTTGAGAAAGG + Intergenic
1049120900 8:140736359-140736381 CAGGGAATAAAACAGCAGGGAGG + Intronic
1050667396 9:7956256-7956278 GAAAGAAAAAAACATCAGGAGGG - Intergenic
1050969089 9:11846329-11846351 GAGGGAAAGAAAGATGGGGAAGG - Intergenic
1051689448 9:19694906-19694928 CAGGGAAATCAACTTGATGAGGG - Intronic
1051689628 9:19696386-19696408 CAGGGAAATCAACTTGATGAGGG + Intronic
1052437390 9:28445854-28445876 GGGGGAAAAAAACATGATTATGG + Intronic
1052475652 9:28956272-28956294 AGGGGAAAAAAACATGAGCAGGG + Intergenic
1052900820 9:33793576-33793598 CAGGAAGAAAAGCAGGAGGAAGG + Intronic
1052902362 9:33804271-33804293 CAGGAAGAAAAGCAGGAGGAAGG + Intergenic
1053004395 9:34594350-34594372 CCAGGAAAACAACTTGAGGAAGG - Intergenic
1054746933 9:68863754-68863776 CAGGCAACAAAACATGAGTGAGG - Intronic
1055271168 9:74560479-74560501 CAGGGAAAATGGCATGAGCAGGG + Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055644107 9:78346661-78346683 GAGGGAGAAAACCATTAGGAGGG + Intergenic
1055838525 9:80474416-80474438 TAAGAAAAAAAAAATGAGGAGGG + Intergenic
1055911958 9:81363500-81363522 CAGGGAAACAACCAAAAGGAAGG + Intergenic
1056395819 9:86180277-86180299 CAGGGAAAGCAAGATGGGGAAGG - Intergenic
1056488191 9:87079998-87080020 CAGGCAAGAAAGCATGTGGAGGG - Intergenic
1056540551 9:87567460-87567482 CAGGAAGAAACACAGGAGGATGG - Intronic
1056650686 9:88458674-88458696 GAGAGAAAAACACATGAGGAGGG + Intronic
1056694424 9:88834048-88834070 CACAGAAAAAAAAATAAGGAAGG + Intergenic
1057002123 9:91519641-91519663 GAAGGAAAAAAACAGGAGGGAGG + Intergenic
1057048001 9:91900507-91900529 CAGGAAACAAGAAATGAGGAAGG + Intronic
1057130603 9:92651678-92651700 CACAGAAAACAACATGAGGGAGG - Intronic
1057527099 9:95812508-95812530 CTGGGAAAAAGAAAAGAGGATGG - Intergenic
1057572711 9:96216535-96216557 CAGGGAAAAGAAGAAGAGCACGG + Intergenic
1059369838 9:113819715-113819737 CAGAGAAACAAAGGTGAGGATGG + Intergenic
1059759579 9:117325352-117325374 CAATGAAAAAGACAGGAGGAGGG - Intronic
1059775075 9:117466085-117466107 CAGGCATAAAAACAAGGGGAGGG + Intergenic
1059780897 9:117525956-117525978 GAAGGAAAAAAATATGAGCAAGG - Intergenic
1060670496 9:125465131-125465153 CAGAGATAAAAACATGAAAAAGG + Intronic
1061741339 9:132708558-132708580 AAGGGAACAAAACCTGAAGACGG - Intergenic
1185485395 X:478065-478087 CCGGAAAAAAAAAATCAGGACGG - Intergenic
1185535549 X:858682-858704 AAGGGAAGAAAACAAAAGGAAGG + Intergenic
1185582690 X:1223165-1223187 CTGGGAGGAAAACAGGAGGATGG + Intergenic
1185639056 X:1576403-1576425 CAGGGAACAAATCATCTGGAAGG - Intergenic
1185827696 X:3268010-3268032 TTGGGAAAAAAATATGAGGATGG - Intergenic
1185882109 X:3750724-3750746 CAGAGACGAAGACATGAGGATGG + Intergenic
1185953059 X:4457788-4457810 CAGAAATAAAAACATGGGGAGGG + Intergenic
1186058882 X:5681854-5681876 AAGGGAAAGAAAAAAGAGGAAGG + Intergenic
1187186594 X:16992566-16992588 CAGCAATAAAAACATAAGGAAGG - Intronic
1187229076 X:17403766-17403788 CAGGAAAAAAAAGATCAAGAAGG - Intronic
1187261547 X:17689197-17689219 GAAGGGAAAAAAGATGAGGAGGG - Intronic
1187261551 X:17689215-17689237 AAAGGAAAAAAAGATGAGGAAGG - Intronic
1188531354 X:31144790-31144812 CAGAGAAAGAGAAATGAGGAAGG + Intronic
1188832976 X:34923841-34923863 CAGAGACATAAATATGAGGAAGG - Intergenic
1189501980 X:41569617-41569639 CAGGGAAAAAAAATTAAGGAAGG + Intronic
1189848168 X:45155492-45155514 CAGGGCAAAAATCATAAGGGTGG + Intronic
1190702957 X:53001679-53001701 GAGGGAGAAAAAGATGGGGAAGG - Intergenic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1192664689 X:73077609-73077631 CAGGGAAAAGGACAGGAAGAGGG + Exonic
1192875440 X:75224723-75224745 CAGGGAATAAAACATGTAGGAGG - Intergenic
1193184483 X:78495990-78496012 GAGGGAAACAAGCATGAGGCAGG + Intergenic
1194034387 X:88853251-88853273 CAGGCAAGAAAACATGTGCAGGG - Intergenic
1194034665 X:88855208-88855230 CAGGCAAAAGAACATGTGCAGGG - Intergenic
1194319957 X:92433635-92433657 TAGTGTAAAAAACATGAGGTTGG + Intronic
1194703286 X:97142382-97142404 GAGAGAAAACAACATGAGCAAGG + Intronic
1194956278 X:100184664-100184686 CAGGGGTAAAAAAATAAGGAAGG - Intergenic
1195018616 X:100802757-100802779 AGGGGAAAAAAAGATGATGAAGG + Intergenic
1195803124 X:108734900-108734922 CAGGGCAAAGAAGATCAGGAAGG - Exonic
1196950536 X:120871991-120872013 CAGTATAAAAAACATGAGTAAGG + Intergenic
1197400670 X:125986009-125986031 CAAAGAAAGAAACATGAGTATGG - Intergenic
1197659488 X:129154770-129154792 CAGGGTGAAAAAGATGAGCAGGG + Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198375258 X:136032450-136032472 CATGTATAAAAACATGATGAGGG - Intronic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199978109 X:152906018-152906040 CATGGAAAAACACATGTGCAAGG - Intergenic
1200628083 Y:5546768-5546790 TAGTGTAAAAAACATGAGGTTGG + Intronic
1200782865 Y:7232482-7232504 CAGAGACGAAGACATGAGGATGG - Intergenic