ID: 960392163

View in Genome Browser
Species Human (GRCh38)
Location 3:117090722-117090744
Sequence CATTAAAGTGGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960392158_960392163 -1 Left 960392158 3:117090700-117090722 CCTCAAGTGACGGTCAGGTTTTC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 960392163 3:117090722-117090744 CATTAAAGTGGGAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 29
4: 302
960392154_960392163 30 Left 960392154 3:117090669-117090691 CCAGTTAGGAGAGATATGACAGT 0: 1
1: 0
2: 0
3: 8
4: 98
Right 960392163 3:117090722-117090744 CATTAAAGTGGGAAGGTGGAAGG 0: 1
1: 0
2: 1
3: 29
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960392163 Original CRISPR CATTAAAGTGGGAAGGTGGA AGG Intronic
900274337 1:1814083-1814105 AATAAAAGTGGGAAGGGGGAGGG - Intronic
900828871 1:4949639-4949661 CATGGAAATGGGAAGCTGGAAGG - Intergenic
901329684 1:8396176-8396198 CAGGAAAGTGGGAGGGGGGAAGG + Intronic
901661244 1:10799232-10799254 CATTATAGTGGGAAAGGGGTAGG - Intergenic
902283070 1:15388416-15388438 CATTAAGGTGAGAAGGCAGAGGG + Intronic
902622321 1:17657685-17657707 AATTAAAGGGGGAAGAGGGAGGG + Intronic
903191455 1:21658819-21658841 CATTCATGTAGGGAGGTGGAGGG + Intronic
903767668 1:25745075-25745097 CAGAAAACTGTGAAGGTGGAGGG - Intronic
905407594 1:37746002-37746024 GAATACAGTGGGAAGGTGGCTGG - Intronic
906727227 1:48052792-48052814 CGTTAAGGTGGGAAGGGGAAGGG + Intergenic
906789122 1:48643329-48643351 CAGCTAAGTGGGTAGGTGGAGGG - Intronic
907756561 1:57316398-57316420 CATTTGAGGGGGAAGGTGGATGG - Intronic
907905526 1:58781719-58781741 TATTAAAGGGGGGAGGGGGAGGG - Exonic
907919566 1:58899774-58899796 CAATAAGGAGGGAAGGTTGAAGG + Intergenic
908898709 1:68930339-68930361 GATTAAAGTGGGAAAGCTGAAGG + Intergenic
909150504 1:71996958-71996980 AATTATAGTAGGGAGGTGGAGGG - Intronic
910067789 1:83174350-83174372 CCTTCAGTTGGGAAGGTGGAGGG + Intergenic
910624730 1:89294091-89294113 CATTCAAAAGGGAATGTGGATGG - Intergenic
911454669 1:98108283-98108305 CAGTAAAGTGGGAGGATGGAAGG + Intergenic
911605966 1:99905520-99905542 CAGCAAAGAGGGAAGATGGATGG - Intronic
911696891 1:100899147-100899169 CGTTCTAGTGGGAAGGTGAAAGG - Intronic
914958270 1:152184172-152184194 CCTGAAAGTGGCAAGGTGGGAGG + Intergenic
917055320 1:170975548-170975570 CATAAAAGTGGGAAGGTGAAAGG - Intronic
917460471 1:175224901-175224923 GAATAAAGTGGGGAGGTGGATGG + Intergenic
919510193 1:198453538-198453560 CATTAGAGAGAGAATGTGGAAGG - Intergenic
920097429 1:203495758-203495780 CACTCAAGTGGGGCGGTGGAGGG + Intronic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
921048746 1:211495854-211495876 CAGCAAAGGGGAAAGGTGGAAGG - Intergenic
921170917 1:212549127-212549149 AATTAAAGTAGGAAGGTGGCTGG + Intergenic
921373268 1:214447502-214447524 CATTTATTTGGGAAGGTTGAGGG - Intronic
921809637 1:219497907-219497929 GTTTAAAGTGGGATGGTGGATGG - Intergenic
921910494 1:220544185-220544207 CAATAAAGTGGGAAGGGAGATGG + Intronic
922325405 1:224523893-224523915 CATTAAGCTGAGAAGGAGGATGG + Intronic
922329855 1:224564909-224564931 AGTTACAGTGGGAAGGTGGATGG + Intronic
923287179 1:232507498-232507520 CATCCAAGTAGGAAGGTGGTGGG + Intronic
923584913 1:235259939-235259961 CTTTTAGGTGGGAAGGAGGATGG - Intronic
923854206 1:237828523-237828545 CATGAATGTGGGAAGGAGGAGGG + Intronic
924633401 1:245763210-245763232 CATTATTGAGGGAAGGAGGAGGG - Intronic
924743147 1:246809427-246809449 CATTGAAGTGGGAGGGAGGCAGG + Intergenic
924903596 1:248428368-248428390 CAATCATGGGGGAAGGTGGAGGG - Intergenic
924924273 1:248663610-248663632 CAATCATGGGGGAAGGTGGAGGG + Intergenic
1063157197 10:3390824-3390846 CATTAAAGTTGGATTGTTGAGGG - Intergenic
1064050900 10:12058607-12058629 AATTAAAGTGGGCAGGGGTAAGG + Intergenic
1064265052 10:13819358-13819380 AATTTAAATGGGAAGGGGGAGGG - Intronic
1064532668 10:16326008-16326030 CTTTAAAGTGGGCAGGTAGCTGG - Intergenic
1064887161 10:20123716-20123738 CAGAAAAGTGGGAAAGGGGATGG + Intronic
1065960769 10:30732439-30732461 CATTCCAGTGGGAATGAGGAAGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066093511 10:32050188-32050210 CTTTGAAGTGGGGATGTGGAGGG - Intronic
1068041381 10:51829333-51829355 ACTCAAAGTGGGAAGGTGGCAGG + Intronic
1070885383 10:79892121-79892143 CTTTAGATTGGGAAGGTGGGGGG - Intergenic
1071544679 10:86520863-86520885 CATTAAAGATGGAAAGCGGACGG + Intronic
1071902443 10:90135761-90135783 TATTAAAGGGCTAAGGTGGAAGG + Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072746224 10:97941052-97941074 AATTGGGGTGGGAAGGTGGATGG - Intronic
1073918614 10:108433539-108433561 AATTAAAATGTGAGGGTGGAGGG + Intergenic
1075608740 10:123834949-123834971 CACTCAAGTCGGAAGGTGAAGGG - Intronic
1076506920 10:130984445-130984467 CCTTTAAGGAGGAAGGTGGAGGG + Intergenic
1077981606 11:7306744-7306766 AATTAAAGTGGGAAGGAGTGGGG - Intronic
1079225944 11:18604849-18604871 CATGAAAGTGTGAAGGGAGAAGG - Intergenic
1079365254 11:19803434-19803456 CATTTCAGTGGGAAAGTGGAAGG - Intronic
1079730762 11:23936195-23936217 CATCAAAATGGGAAGGAGAAGGG - Intergenic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1081871393 11:46384212-46384234 CATGACAGTGGGAAGGGGGGAGG - Intergenic
1082662289 11:55926480-55926502 GATTAAAGTGGCAAGGATGAAGG + Intergenic
1082688501 11:56270350-56270372 AATTACAGTGGAAAGTTGGAAGG + Intergenic
1082818676 11:57528664-57528686 TATTAAAGTGGGAAGGGGTGGGG + Exonic
1084905549 11:72343583-72343605 AATAAAAGTGGAAAGGTGGTGGG + Intronic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1088597215 11:111449534-111449556 CATTTGAATGGGAGGGTGGAGGG - Intronic
1090964117 11:131583300-131583322 CAGTATATTGGGGAGGTGGATGG - Intronic
1091176266 11:133561060-133561082 AAAGAAAGTGGGAAGCTGGAAGG - Intergenic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091943989 12:4518379-4518401 CATTAAAATGGGAAGTTGCAAGG - Intronic
1092122954 12:6057274-6057296 CAGTAGACTGGGAAGGTCGAAGG + Intronic
1092701905 12:11241210-11241232 CATTTTAGATGGAAGGTGGATGG + Intergenic
1092918752 12:13211925-13211947 AGTGAAAGAGGGAAGGTGGAAGG + Intronic
1093829742 12:23740747-23740769 TATTTAACTGGGGAGGTGGAAGG + Intronic
1094826948 12:34276700-34276722 CCTGAAAGTGGGGAGATGGATGG - Intergenic
1096518074 12:52169100-52169122 CAGTAAAGGCGGAAGGTGAAGGG + Exonic
1096880665 12:54666396-54666418 CAATAAGGTTGGATGGTGGATGG - Intergenic
1099009368 12:77273640-77273662 CATTAAAGTAGGAGGTAGGAAGG - Intergenic
1099653174 12:85456080-85456102 AGATAAATTGGGAAGGTGGAAGG - Intergenic
1100754924 12:97740817-97740839 CCTTAAAGTGAGAAGATGGATGG + Intergenic
1100800638 12:98226823-98226845 CAATCAAGGTGGAAGGTGGAAGG - Intergenic
1100871010 12:98910029-98910051 CAGTTAGCTGGGAAGGTGGAGGG + Intronic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1103172318 12:118832269-118832291 TGTTAAAGTGGGAAGGAGGAAGG + Intergenic
1104509412 12:129362913-129362935 AATTAAAGTTAGAAGGTTGAAGG - Intronic
1107102907 13:36613165-36613187 CAATGAAGTGGGAACATGGAAGG - Intergenic
1107283534 13:38763695-38763717 CATTTTGGTGGGAAGATGGAAGG + Intronic
1107905670 13:45058809-45058831 CATAAAAGTGAGAACGTGGCTGG + Intergenic
1108713426 13:53056345-53056367 CATTAGATTTGAAAGGTGGAAGG - Intergenic
1108937167 13:55896850-55896872 AATTAAAGTGGGAAAGGGAAAGG + Intergenic
1112842192 13:103593794-103593816 CAATACAGTGGGAAGGTCTAGGG + Intergenic
1113004873 13:105688973-105688995 CATTTCAGTGTGAAGGAGGAAGG - Intergenic
1113540807 13:111107512-111107534 ACTTAAAGTTGGAAGGTGGGAGG + Intergenic
1113660102 13:112101439-112101461 TATAAAAGTGGAAAAGTGGAAGG + Intergenic
1114566683 14:23638447-23638469 CATTTAACTGGGAAGCTGCATGG + Intronic
1115826516 14:37284260-37284282 CATCTCAGTGGGAAGGTGGAAGG - Intronic
1116357289 14:43945423-43945445 CAGTAAAGTGAAAAGGTGTATGG + Intergenic
1116634577 14:47378749-47378771 CATTAAAGTGGCAAAGAGAATGG + Intronic
1117292668 14:54348761-54348783 CAAAAAAGTGGGGAGATGGATGG + Intergenic
1118652742 14:67915071-67915093 CATTACAGGGGGAAGTTAGAGGG + Intronic
1118678744 14:68217090-68217112 GTTTAGAGTGGGAAGGTGAAAGG - Intronic
1119590947 14:75887328-75887350 CATTAAAGTGAGAAGATTTAAGG + Intronic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1124889568 15:33719897-33719919 CATAATAATGGGATGGTGGAAGG - Intronic
1125466520 15:39958509-39958531 CATTAAAGTATAAAGGTGTAGGG + Intronic
1126759857 15:51960096-51960118 AATTAAAGTGTGGAGGTTGAAGG - Intronic
1126843582 15:52739748-52739770 CAGAAAAGTGGGAAAGTGGTCGG - Intergenic
1127904020 15:63362884-63362906 AAGTATAGTGGGAAGGTCGAGGG + Intronic
1129037726 15:72661100-72661122 CAGTAAAGTTGGAAGGGAGAGGG - Intronic
1129085266 15:73082959-73082981 CTTTAAAGTGGGAAGGAGAGTGG + Intronic
1129212160 15:74076121-74076143 CAGTAAAGTTGGAAGGGAGAGGG + Intronic
1129398236 15:75264958-75264980 CAGTAAAGTTGGAAGGGAGAGGG - Intronic
1129401848 15:75289233-75289255 CAGTAAAGTTGGAAGGGAGAGGG - Intronic
1129839216 15:78733501-78733523 CAGTAAAGTTGGAAGGGAGAGGG - Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1134301502 16:12995620-12995642 CTTAACAGTGGGAAGGTGGAAGG - Intronic
1135659674 16:24284900-24284922 CATTGAAGGGGAAAGGTTGAAGG + Intronic
1136255001 16:29032637-29032659 CTTTGAAGAGGGAAGGTGCAGGG + Intergenic
1137483978 16:48876458-48876480 TGTTAAAATGGGAAGGTGGCAGG - Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138195757 16:55050996-55051018 CCTTGGAGTGGGAAGGAGGAGGG - Intergenic
1138231205 16:55337768-55337790 CACTGAAGGGGGAAAGTGGATGG - Intergenic
1138718677 16:59053325-59053347 CATTCAACTGGGAAACTGGATGG + Intergenic
1139083454 16:63555031-63555053 CATTAAATTAGAAATGTGGATGG - Intergenic
1139875867 16:70145508-70145530 CAGTTAGGTGGGAAGGTGGGAGG - Intronic
1140359920 16:74335590-74335612 CAGTTAGGTGGGAAGGTGGGAGG + Intergenic
1141103666 16:81215813-81215835 CAGGAAGGTGGGCAGGTGGATGG + Intergenic
1141832819 16:86519212-86519234 CATTGAGGTGGGAAGGTGTGCGG + Intergenic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1142348521 16:89569422-89569444 CATCAGAGTGGGCAGGGGGAGGG + Intergenic
1144302511 17:13935169-13935191 CATTGAACTGGGAATGTGAACGG + Intergenic
1146539368 17:33681107-33681129 CATTCAACTGGGAAGGAGAAAGG - Intronic
1147033388 17:37660345-37660367 CATTAGACTGGGAAAGTGTAAGG + Intergenic
1148628102 17:49085784-49085806 CATTTAAGTGGGATGAGGGAAGG + Intergenic
1150192725 17:63260126-63260148 CTTTAAAGTGGGAAGGAAGGAGG + Intronic
1152335840 17:79699941-79699963 CATGAAAGTGGGCAGGTCCAGGG - Intergenic
1154220352 18:12447563-12447585 CATTAAAGAGGTCACGTGGAGGG - Exonic
1154281262 18:13005227-13005249 CATTAAAGTAGTAAGGTGAAAGG + Intronic
1154310875 18:13265413-13265435 CAGCACAGTGGGAAGGGGGAGGG - Intronic
1155693778 18:28659051-28659073 CATTAATGGTGGAAGATGGAAGG - Intergenic
1155697688 18:28702160-28702182 CAGGTAAGTGGGTAGGTGGAGGG + Intergenic
1155995831 18:32330684-32330706 CATTTAAATGGGAGGGTGGGAGG + Intronic
1156618930 18:38825582-38825604 CAGAAAAGTGGGAAAGTGGGAGG - Intergenic
1156968729 18:43129327-43129349 TCTTAAAGTGGGGAGCTGGAAGG + Intergenic
1157197833 18:45634072-45634094 CTTTAAATTGGGAAGTGGGATGG - Intronic
1157654209 18:49369341-49369363 TATTAAACTGGGAAGGGGGGTGG + Intronic
1158258920 18:55587249-55587271 GATTAAGGTGGAAAGGAGGAAGG + Intronic
1159342438 18:67153261-67153283 CATTAAAATGTGTAGTTGGAGGG + Intergenic
1159639924 18:70851701-70851723 TAGCAAAGTGGGATGGTGGATGG - Intergenic
1162406833 19:10479795-10479817 CCTTAAACTGGAAAGGAGGAAGG - Intergenic
1162866125 19:13548471-13548493 GATGAAAGTGGGGAGGGGGATGG + Intronic
1163058414 19:14740130-14740152 CAATAATATGGGAATGTGGAAGG + Intronic
1163567653 19:18060978-18061000 CTTTAAAATGGGAAGGGGTATGG + Intronic
1165194222 19:34088836-34088858 AATTAAAGATGGAAAGTGGATGG + Intergenic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1166385617 19:42378909-42378931 TCTTAAAGGGGGAAGGGGGAAGG + Intergenic
1168637033 19:58004253-58004275 CATGAGAGAGGTAAGGTGGAAGG + Intronic
925330327 2:3053539-3053561 AATAAAAGTGGGAAGGAGGGAGG + Intergenic
925751281 2:7091972-7091994 CAGTAGAGTGGGAAGATGGTGGG - Intergenic
927135936 2:20096614-20096636 GATTAAAGTGGGAAGGGGCCAGG - Intergenic
927608291 2:24509474-24509496 CATTCATGAGGAAAGGTGGATGG + Intronic
928136789 2:28693795-28693817 CATCCAAGGGGGAAGGAGGATGG - Intergenic
928787176 2:34902788-34902810 AAATAAAGTGGGATGGGGGAAGG - Intergenic
933854987 2:86404319-86404341 CACTGAGTTGGGAAGGTGGAGGG - Intergenic
934592002 2:95561993-95562015 CAGTAGAGAGGGAAGGTGGCTGG - Intergenic
935690989 2:105732444-105732466 GAGTAAAGTTGGGAGGTGGAAGG - Intergenic
936344625 2:111665888-111665910 CATCACAGAAGGAAGGTGGAAGG - Intergenic
943060358 2:183037467-183037489 AAATAAAGTGGCAAAGTGGAGGG + Intronic
944274490 2:197820135-197820157 CATTTAAGTTGGAAGTAGGAAGG + Intronic
944301248 2:198127178-198127200 CAGTAAAGAGGGTATGTGGATGG - Intronic
947114005 2:226749731-226749753 TATGAAAGTGGGAAGGAAGATGG + Intronic
947584716 2:231347233-231347255 CATTATAGTGGGAAGGTCCATGG - Intronic
947912531 2:233810907-233810929 CATTATAGTGGTAAGCTGGGTGG + Exonic
948073761 2:235149105-235149127 CTTGAAGGTGTGAAGGTGGATGG - Intergenic
1170136686 20:13082205-13082227 TATTTATGTGGGAAGATGGAAGG - Intronic
1170587581 20:17746616-17746638 AATTAAAATTGGAAGGTGTAAGG - Intergenic
1170904144 20:20497062-20497084 CTTTTATGTGGGAAGGAGGAAGG - Intronic
1171447921 20:25217746-25217768 CATTAAAGGATGAAGGAGGAGGG - Intronic
1172861320 20:38054855-38054877 CATCAAAGTGGTCATGTGGAAGG - Intronic
1174468968 20:50741402-50741424 GGTAAAGGTGGGAAGGTGGAGGG - Intronic
1174846617 20:53949063-53949085 CATGAAAATGGGAAAGGGGAAGG + Intronic
1175649048 20:60701132-60701154 CAATAAAAAGGGAGGGTGGATGG - Intergenic
1178511289 21:33207142-33207164 CATTAAGGTGGGGTGGTGGAAGG - Intergenic
1179805270 21:43833199-43833221 GAGTCAAGTGGGAAGGTGGCCGG - Intergenic
1180901312 22:19375429-19375451 CCTTGAAGTGGGAAGGTGGCTGG - Intronic
1181267530 22:21639487-21639509 AATTATAGTTGGTAGGTGGAGGG + Intergenic
1182030349 22:27154640-27154662 CATTTACCTGGGAGGGTGGATGG - Intergenic
1182999722 22:34845079-34845101 CATTCAAGGAGGAAGGTGAAGGG - Intergenic
1183062978 22:35346914-35346936 CATTACCCTGGGAAGGTAGAAGG - Exonic
1185375130 22:50479126-50479148 CATTTATGTTGAAAGGTGGAGGG - Intergenic
952588971 3:34928304-34928326 CATAGAAGTGGGAGGGTGGGAGG + Intergenic
954366640 3:50149995-50150017 CATGAAAGTGGTAAGGGTGAAGG - Intergenic
954856219 3:53646106-53646128 CATGGAGGTGGGAAGGTGGCTGG + Intronic
955761085 3:62283445-62283467 TATTAAAGTGGAAAGGTGCTGGG - Intronic
955787691 3:62557347-62557369 CATTGATTTGGGAAGGTTGAGGG + Intronic
957575960 3:82008512-82008534 CAATATAGTGTGAAAGTGGATGG + Intergenic
958055400 3:88404541-88404563 GCTTAAAGAGGGAAGGTTGAAGG - Intergenic
959605240 3:108235113-108235135 CAATAAAGTGGGAATGTTCAAGG - Intergenic
960392163 3:117090722-117090744 CATTAAAGTGGGAAGGTGGAAGG + Intronic
960928757 3:122822961-122822983 CAACACAGTGGGGAGGTGGAGGG - Intronic
961212406 3:125135933-125135955 CCTAGAAGTGGGAAGGTAGATGG - Intronic
962661402 3:137604226-137604248 CATTAGAGTGGGAGGGAGCAAGG - Intergenic
963641988 3:147872394-147872416 AATTAAAGTTGGGAGGTAGAGGG + Intergenic
963750176 3:149169715-149169737 CATTAAAATGGGTTAGTGGATGG + Intronic
964028241 3:152104477-152104499 CATTAAAGTTTGAGGGTGGCCGG + Intergenic
964606410 3:158565092-158565114 ACTTGAGGTGGGAAGGTGGAAGG - Intergenic
967244335 3:187470822-187470844 CAGTAAAGTGGGAAAGGGGTTGG + Intergenic
967484105 3:190010017-190010039 CATTAAAGCTGGAAGTTGGAAGG - Intronic
969497375 4:7533820-7533842 CTGTAAAGCGGGCAGGTGGAAGG + Intronic
970564165 4:17315143-17315165 CAATCAAATGGGAAGGGGGAGGG + Intergenic
971116436 4:23651464-23651486 CATTATAGAGCAAAGGTGGAGGG + Intergenic
971913100 4:32822057-32822079 CATTAAACTAGCAAAGTGGAGGG + Intergenic
972265511 4:37455192-37455214 GATTAAATGGGGAAGGGGGAGGG - Intronic
972340355 4:38147605-38147627 CTTGAAGCTGGGAAGGTGGAGGG - Intergenic
975589509 4:75986334-75986356 CAGAAAAGTGGGAAAGTGAAGGG - Intronic
976336337 4:83892301-83892323 GATTGAAGTGTGAAGGTGAAGGG - Intergenic
976500741 4:85786090-85786112 CATACAATTGGGAAGTTGGATGG + Intronic
977753789 4:100641046-100641068 AAACATAGTGGGAAGGTGGAGGG + Intronic
978544608 4:109857586-109857608 CTTTAAAGTGGAAAGGGGCAGGG - Intronic
979793019 4:124809932-124809954 CATTTCAGTGGGAAAGTGGAAGG - Intergenic
980396256 4:132219758-132219780 CATGACATTGGCAAGGTGGAAGG - Intergenic
981783028 4:148446215-148446237 CAGGACAGTGGGAATGTGGAAGG - Intergenic
983610437 4:169638665-169638687 CGGCAACGTGGGAAGGTGGAAGG - Intronic
984595455 4:181662364-181662386 CATTAAAGTAGGAAGGCCCAAGG - Intergenic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
987162032 5:15154803-15154825 CAATCATGGGGGAAGGTGGAGGG + Intergenic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
989736137 5:44709505-44709527 CATTTGAGTGGGAAGAGGGATGG - Intergenic
990560818 5:56981187-56981209 CATCAAAGTGGGAGGGAGGACGG + Intergenic
991312543 5:65260064-65260086 CATTAAAGTAAGAAGGTGAAAGG + Intronic
991645389 5:68795827-68795849 CATCAAAATGGGGAGGTGGGAGG - Intergenic
991723996 5:69517806-69517828 CTTTAAAGTGTGAAGGTGTTAGG + Intronic
992744660 5:79807293-79807315 CATTCATGTGGGGAGGTAGAGGG + Intergenic
993330547 5:86594696-86594718 CATTATATAGGGAAGGTGGGCGG - Intergenic
994977653 5:106830498-106830520 GATTAAATCTGGAAGGTGGAAGG + Intergenic
997764180 5:136483163-136483185 AATAAGAGTGGGAGGGTGGAAGG - Intergenic
999936722 5:156494721-156494743 CAGAAAAGTGGGAAGGAAGAAGG - Intronic
1000085644 5:157885438-157885460 CATCAAAGTGGGAAGGAGATGGG + Intergenic
1000288269 5:159846543-159846565 CATTAACATGGGGAGGAGGAAGG + Intergenic
1000901175 5:166913368-166913390 TAAGAAAGTGGGAAGCTGGAAGG - Intergenic
1001174827 5:169458547-169458569 CATTAAAATGTCAAGGTGGGAGG + Intergenic
1001439922 5:171734819-171734841 CAAGCAAGTGAGAAGGTGGAAGG - Intergenic
1001790560 5:174454203-174454225 CTCCAAAGTGGGAAGCTGGAGGG + Intergenic
1002148975 5:177210881-177210903 TCTAAAAGTGGGAAAGTGGATGG + Exonic
1002706630 5:181164921-181164943 CTTTAAAGTGAGAGGGTAGAAGG - Intergenic
1003159299 6:3621660-3621682 CATTATGGTGGGTAGGTGGGAGG - Intergenic
1005956337 6:30665850-30665872 CATTGCAGAGGGAAGGTAGAGGG - Intronic
1006711654 6:36078347-36078369 CAATTAAGTGAGAAGGTGAAGGG - Intronic
1006806186 6:36791149-36791171 TATAAAAGTGGGAAAGTGGTGGG - Intronic
1007322307 6:41036426-41036448 CAACAAATTGAGAAGGTGGAAGG + Intronic
1009942472 6:70305091-70305113 CATTACAGTGGGAAGGAGAGGGG - Intergenic
1011803296 6:91042929-91042951 CCTTAAAGCGGGAAGGAGGATGG + Intergenic
1012454848 6:99392534-99392556 AAGTAAAGTGTGTAGGTGGAGGG - Intronic
1013707455 6:112854903-112854925 GATTGGAGTGGGGAGGTGGAGGG + Intergenic
1014366072 6:120543685-120543707 CAGTAAAGTGGGAAGTTTAAGGG + Intergenic
1014495553 6:122117709-122117731 CATTAAAGTAGGCAGGTCAAAGG - Intergenic
1016809057 6:148242293-148242315 CATTCCAGTGGGAACCTGGATGG + Intergenic
1021665506 7:22974249-22974271 CAAAAAGGTGGGAGGGTGGAAGG - Intronic
1022311696 7:29202467-29202489 CAACAAAATGGGAAGGTGGAAGG + Intronic
1023494290 7:40778010-40778032 CACTAGAGTGGAAAGGTGGTGGG - Intronic
1023891325 7:44393961-44393983 CTTGGAGGTGGGAAGGTGGAAGG - Intronic
1023969048 7:44978256-44978278 CATCAAGGAGGGCAGGTGGAGGG - Intronic
1024377882 7:48659639-48659661 CATTAAAAGGGGAAGGAGTAAGG - Intergenic
1026023465 7:66728024-66728046 AATTACACTGGAAAGGTGGAAGG - Intronic
1027235086 7:76293273-76293295 CTAGAAAGTGGGTAGGTGGAGGG - Intergenic
1027276308 7:76560411-76560433 CCTTCAGTTGGGAAGGTGGAGGG - Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029222225 7:98999658-98999680 AATGAAGGTGGGAAGGAGGATGG + Intronic
1029568760 7:101357534-101357556 CATTATGCGGGGAAGGTGGAAGG + Intergenic
1032680205 7:134174671-134174693 GAAGAAAGTGGGATGGTGGAGGG + Intronic
1032964414 7:137079287-137079309 CATTTAAGTGGGAGTGTGAAAGG + Intergenic
1033075277 7:138244123-138244145 CATTAGAATGGGAAGGAGGAAGG - Intergenic
1033412438 7:141130837-141130859 AATTAAGGTGTGAAGTTGGAAGG - Intronic
1033488048 7:141811121-141811143 AAATAGAGTGGGAAGGTGGCTGG - Intergenic
1036015767 8:4782107-4782129 CATTACAGTAGGGAGGAGGAAGG + Intronic
1037376484 8:18235618-18235640 CTTTACAGTGGGAAGAGGGAAGG + Intergenic
1037425153 8:18747540-18747562 TATTAAAGTGGGAAAATGAATGG + Intronic
1038923226 8:32109213-32109235 CATGAAAGTGGGAAGATGTTTGG - Intronic
1039213232 8:35238926-35238948 AAGTAAAGTGGGAAGGAAGAGGG - Intronic
1039841368 8:41295620-41295642 TATTTAAGTGAGAGGGTGGATGG - Intronic
1039858796 8:41438808-41438830 CATTTCAGTGGGATGGTGGGAGG - Intergenic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1041399499 8:57427345-57427367 TATTACAGTGGGAAGGTGAGAGG + Intergenic
1041843951 8:62305703-62305725 CACTAAAGTGTGATGATGGATGG + Intronic
1045799261 8:106082803-106082825 CATTAAAGTGGGTGGGAGGCAGG + Intergenic
1046744274 8:117860346-117860368 CCTCAAGGTGGGAGGGTGGAAGG + Intronic
1046761017 8:118020835-118020857 CATTAAAGTTAGAAGGAGGGTGG - Intronic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1048437409 8:134431429-134431451 CATGGAAGTGGGCAGGTGGCTGG + Intergenic
1048526698 8:135209275-135209297 CAGCAAAGTGAGAAGTTGGAGGG + Intergenic
1048555940 8:135476131-135476153 CAAAAAAGTGGGAAGATGGAAGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049467052 8:142756395-142756417 CATAAGGGTGGGAAGGGGGAAGG - Intergenic
1050739333 9:8802241-8802263 CATTAAAGTGAAATGGTGAAGGG + Intronic
1051380351 9:16451715-16451737 AATGGGAGTGGGAAGGTGGAAGG - Intronic
1052150956 9:25115126-25115148 GAGTAAAGTGGCAAGGTGGGAGG - Intergenic
1052616121 9:30844073-30844095 CAGGAAAGAGGGAAGGTTGAGGG + Intergenic
1054454326 9:65421791-65421813 CATTAAGGTGGGTGGATGGATGG + Intergenic
1054858177 9:69923643-69923665 CATTAAGCTGGGAAAGGGGAAGG - Intergenic
1055700859 9:78944343-78944365 CATTAATGTGAGAAGGAGGTAGG + Intergenic
1055720584 9:79168828-79168850 CATTAAAGGGAAAAGGTGTATGG - Intergenic
1057159923 9:92882396-92882418 CTGGAAGGTGGGAAGGTGGAGGG + Intergenic
1058564792 9:106271083-106271105 GACTAAAGTGGGTAGGAGGAGGG - Intergenic
1058666253 9:107318731-107318753 CACTAAAAAGGGAGGGTGGAGGG - Exonic
1059350129 9:113658536-113658558 CATGAATGTGGGAGGGAGGAAGG + Intergenic
1059989150 9:119848184-119848206 CATGAAAGTGGGTCGGTGAACGG - Intergenic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1062129051 9:134882927-134882949 TGTTGAGGTGGGAAGGTGGAGGG - Intronic
1062659312 9:137620125-137620147 AAGTAAACTGGGAAGGTGCAGGG + Intronic
1186503597 X:10072193-10072215 CAATAAAGGGGGCAAGTGGAAGG + Intronic
1187514539 X:19956214-19956236 CATTAAAGTGGTAAGATAGCCGG - Intronic
1188281487 X:28275236-28275258 GATGAAGCTGGGAAGGTGGAAGG + Intergenic
1189257532 X:39652143-39652165 CATGAAAGAGGGAATGAGGAAGG - Intergenic
1190845283 X:54185013-54185035 TATAAATGGGGGAAGGTGGAGGG - Intergenic
1190991992 X:55561354-55561376 CAGAAAAGTGGGAAGATGTATGG + Intergenic
1192630625 X:72775343-72775365 CATTAACATGAGAAGATGGAGGG - Intergenic
1192651085 X:72945461-72945483 CATTAACATGAGAAGATGGAGGG + Intergenic
1194399339 X:93423302-93423324 GAATAATGTGGGGAGGTGGAGGG + Intergenic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1195805124 X:108757038-108757060 TATAAAAGTGGGAAGGATGAAGG + Intergenic
1196456973 X:115897945-115897967 CATTGAGGTGGGAAGGTAAATGG + Intergenic
1196753670 X:119139362-119139384 CAGGAAAGTGGGAAGGTGGGAGG + Intronic
1197470789 X:126864248-126864270 CATAAAAGTGGGAAAGGGGTTGG - Intergenic
1198432061 X:136577237-136577259 CATTAAAGTGGTTGAGTGGATGG - Intergenic
1200559101 Y:4677543-4677565 TATTAAAAAGGTAAGGTGGAAGG - Intergenic
1201574381 Y:15446454-15446476 CACACAAGTGGGAAGGAGGATGG + Intergenic
1201743216 Y:17345112-17345134 GAGTAATTTGGGAAGGTGGAAGG + Intergenic
1201774704 Y:17649881-17649903 CCCTAAAGCGGGGAGGTGGATGG - Intergenic
1201826852 Y:18256108-18256130 CCCTAAAGCGGGGAGGTGGATGG + Intergenic