ID: 960395392

View in Genome Browser
Species Human (GRCh38)
Location 3:117131090-117131112
Sequence ATGTCGAAGAGGAAGCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960395392 Original CRISPR ATGTCGAAGAGGAAGCTGGA CGG Intronic
905303176 1:36999279-36999301 AGGTGGGAGAGGAAGCTGCAGGG + Intronic
905405258 1:37728218-37728240 GTGGCAAATAGGAAGCTGGAGGG + Intronic
905792470 1:40797613-40797635 CTGGCGAGGAGGATGCTGGAGGG + Intronic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
908961616 1:69704411-69704433 ATGAGGAAATGGAAGCTGGATGG - Intronic
910208986 1:84774967-84774989 ATGAAGGAGAGGAAGATGGATGG - Intergenic
910766776 1:90790009-90790031 ATGGCGAAGAGGGAGATGGAAGG + Intergenic
910900479 1:92115116-92115138 AAGTCGAACAGGAAGCTCAATGG - Intronic
911675621 1:100655354-100655376 ATCTCCAAGAGGCAGCTGGCTGG + Intergenic
915605405 1:156947243-156947265 AAGTGGAACAGGAAGCTGAAGGG + Intronic
915903228 1:159861138-159861160 AAGTGGAAGAGAGAGCTGGATGG + Intronic
915933724 1:160077629-160077651 AAGTGGAAGAGGAAGCATGATGG - Intergenic
917225497 1:172777574-172777596 AGGTCGAAGAGGAAGCAAAATGG - Intergenic
917452884 1:175161855-175161877 ATGAGGAAGAGGAAGGTAGAAGG - Intronic
918206626 1:182315306-182315328 ATGTGGACTAGGAAGCTGGAGGG - Intergenic
918706083 1:187664096-187664118 ATCTCGAAGAGGAAGCAGAGAGG - Intergenic
919322787 1:196064508-196064530 ATGTATAGGAGAAAGCTGGAGGG - Intergenic
920003596 1:202816085-202816107 ATGTGGATGAGGAACCTGGGTGG + Intergenic
922889905 1:229053829-229053851 ATGTGGAAATGGAAGCTGGGAGG - Intergenic
924813614 1:247424323-247424345 ATGAGGAAGAGGATTCTGGAGGG - Exonic
1064193970 10:13230631-13230653 ATGTGCAAGAGGAGGCTGGGGGG + Intronic
1064393354 10:14959928-14959950 ATGGCAGAAAGGAAGCTGGAGGG + Intronic
1064659372 10:17591114-17591136 ATGGAGAAGAGGAGGCTGGGTGG - Intronic
1065508887 10:26457637-26457659 AGGCTGAAGAGGAGGCTGGAAGG + Intronic
1069408311 10:68126187-68126209 AGGTTGAAGAGGTAGGTGGAAGG + Intronic
1069944618 10:71977299-71977321 ATGTTGAAGGGGCAGCTGGGAGG - Intronic
1071927808 10:90430990-90431012 ATGTCGAAGATGAAGCCTGCAGG - Intergenic
1074783310 10:116817980-116818002 GAGAGGAAGAGGAAGCTGGAGGG - Intergenic
1076941471 10:133612858-133612880 ATGTCCAGGAGGAAGTTAGATGG + Intergenic
1077611668 11:3646740-3646762 ATGTCCAAGAGGTAGCAGAATGG - Intronic
1079782674 11:24627839-24627861 TTGGAGAAGAGTAAGCTGGAGGG - Intronic
1080117053 11:28632931-28632953 CTCTCCAAGAGGAAACTGGAGGG - Intergenic
1080866452 11:36199685-36199707 ATGACACAAAGGAAGCTGGACGG - Intronic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081372845 11:42325190-42325212 ATGTGGAATATGAGGCTGGATGG + Intergenic
1081374201 11:42339778-42339800 ATGTTGAAGAGGCAGCTGGATGG + Intergenic
1083608574 11:63993850-63993872 GTTTCAAAGAGGAAGCTGGCCGG + Intronic
1083997587 11:66279735-66279757 ATGTCAAAGAGCAAGGTGGCAGG - Intronic
1084274293 11:68043806-68043828 ACGTGGCAGTGGAAGCTGGAGGG - Exonic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087439221 11:98161550-98161572 ATGTCAAAGAGGCAGCTGAATGG + Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088777604 11:113100619-113100641 ATGTCAAAGAGGCAGCTGAACGG - Intronic
1089932749 11:122330505-122330527 ATTACAGAGAGGAAGCTGGAGGG - Intergenic
1091391578 12:129406-129428 AGGGAGAACAGGAAGCTGGAGGG - Intronic
1091934480 12:4424159-4424181 AGGTCGCAGAGGAGGTTGGAGGG - Intergenic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1093641882 12:21537038-21537060 ATGAGGAAGAGGAGGCTGAAAGG - Exonic
1093769090 12:22998905-22998927 ACATCGAAGAGGAAGCTGGATGG + Intergenic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1096814938 12:54196044-54196066 ATTTTGAAGAGGGAGCTGGAGGG - Intergenic
1101557584 12:105824707-105824729 AAGTCGAAGTGGGAGCAGGAAGG + Intergenic
1101635696 12:106539671-106539693 ATGTCAAGGAGGAACCTGGTGGG - Intronic
1102416468 12:112767123-112767145 ATATCAAAGAGGAAGCTGTGGGG - Intronic
1103793049 12:123485086-123485108 CTGTTGAATAGAAAGCTGGAAGG - Intronic
1106310284 13:28548345-28548367 TTGTCCTATAGGAAGCTGGATGG + Intergenic
1107081526 13:36379906-36379928 ATGTCTAGGAGGATTCTGGATGG - Intergenic
1107450514 13:40504554-40504576 AGGTTGAAGAGGAAGTTGGCTGG - Intergenic
1108415377 13:50193107-50193129 ATCTCGAAGAGGCAAGTGGAAGG - Intronic
1108577444 13:51802456-51802478 ATGGGGAGGAGGAAGCTGGCAGG + Intronic
1111741504 13:92211344-92211366 ATGAGGAAGAGCAAGATGGATGG - Intronic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1113894801 13:113757000-113757022 ATGTTGAAGACCAAGCTTGAGGG - Intergenic
1114347153 14:21808166-21808188 ATGTCGCAGAGGAAGAAGAATGG - Intergenic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1114663618 14:24366495-24366517 ATTTCCGAGATGAAGCTGGAAGG + Intronic
1118375320 14:65171777-65171799 AAGAAGAAGAAGAAGCTGGAAGG + Intergenic
1121001739 14:90455973-90455995 TTGTGGAAGAGGCAGCTGGCTGG + Intergenic
1122437102 14:101707751-101707773 AGGTCGAACAGGAAGCAGTATGG - Intergenic
1122771228 14:104098772-104098794 ATGGCAGGGAGGAAGCTGGAGGG + Intronic
1124550933 15:30680735-30680757 ATCTCCAAGAGGAATGTGGATGG - Intronic
1124613923 15:31228143-31228165 ATGAAAAAGAGGAAGCTAGAGGG + Intergenic
1124680320 15:31724934-31724956 ATCTCCAAGAGGAATGTGGATGG + Intronic
1127026013 15:54807552-54807574 ATTTCTAAGAGGTAACTGGATGG + Intergenic
1127362576 15:58257794-58257816 ATTTCCCAGAGGATGCTGGAGGG - Intronic
1129336828 15:74857208-74857230 CTGTCGCAGAGGAGGTTGGAAGG - Intronic
1131058617 15:89391055-89391077 GTGGCAAAGAAGAAGCTGGAGGG + Intergenic
1131430862 15:92387842-92387864 ATGGTGGAAAGGAAGCTGGAAGG + Intergenic
1133553057 16:6877253-6877275 ATGTCCTAGAGAAAGATGGATGG + Intronic
1134411302 16:14004736-14004758 ATTTGGAAGAGGAAGCTTCAGGG + Intergenic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1140451296 16:75072882-75072904 ATCTCAGAGGGGAAGCTGGAGGG - Intronic
1141108048 16:81249776-81249798 AGGTCTAAGAGAAAGATGGAGGG - Intronic
1141174992 16:81712927-81712949 AGGTAGCAGAGGGAGCTGGATGG - Intergenic
1141500925 16:84443534-84443556 AAGTCCAGGAGGAAGCAGGAAGG - Intronic
1141791673 16:86241092-86241114 TTGTGGAAGAGGCAGCTGTATGG - Intergenic
1142000338 16:87660680-87660702 CTGTGGAAGAGGCAGCTGGTGGG - Intronic
1143272408 17:5685525-5685547 ATGGTGAAGAGGAGGCTGGAGGG + Intergenic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1143919583 17:10320426-10320448 AGGGCGAAGAGGAAGCTGGAAGG - Exonic
1147162398 17:38575797-38575819 AGGTCCTAGAGGAATCTGGAAGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150844787 17:68644499-68644521 TTGTTGAAGAGGAAACTAGATGG - Intergenic
1150919593 17:69469254-69469276 AAGTGGAAGAGGAAGGTAGAGGG - Intronic
1152058767 17:78052727-78052749 AAGTCTACGAGGAGGCTGGAGGG - Intronic
1153579901 18:6562482-6562504 ATGTGGTAGAGGAAACTTGAAGG - Intronic
1153950749 18:10055718-10055740 ATGTTGAAGAGAAATTTGGAAGG + Intergenic
1155793666 18:30006178-30006200 ATATGGTAGAGGAATCTGGAGGG + Intergenic
1159898402 18:74019282-74019304 ATGGCAAAGAGAACGCTGGAGGG + Intergenic
1160532435 18:79573425-79573447 ATCTAGAAGAGGAGGCTGGAAGG + Intergenic
1162889388 19:13721487-13721509 ATGGTCATGAGGAAGCTGGAGGG + Intergenic
1164870668 19:31640459-31640481 AGGGCGAAGTGGGAGCTGGAGGG + Intergenic
1166040503 19:40199609-40199631 ATGTAGGAGAGGGAGCTGGAAGG + Intronic
1166400197 19:42473072-42473094 AGGTTGGAGAGGAAGGTGGAGGG + Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168421571 19:56207552-56207574 ATGTCTTTGAGGAAACTGGATGG - Intronic
926352939 2:12013853-12013875 GTGTGGGAGAGCAAGCTGGAGGG + Intergenic
927970950 2:27306223-27306245 ATGTCGAAGGTGGAGCTGGCAGG + Exonic
928400573 2:30975277-30975299 ATGTCGATGATGAAGCAAGAGGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929098213 2:38284158-38284180 ATGTAGAAAATGAAGTTGGAAGG - Intergenic
930380536 2:50622166-50622188 ATGTCAATGAGGGATCTGGAAGG + Intronic
932437288 2:71710004-71710026 AAGTCAAAGGGGAAGATGGAGGG - Intergenic
932488307 2:72101050-72101072 ATGTTGAAGAGCAAGGTGGATGG - Intergenic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
933947573 2:87300035-87300057 GTGTTGAAGAGGTAGCTGGAAGG - Intergenic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935744507 2:106178862-106178884 ATGTGATAGAAGAAGCTGGAAGG - Intronic
936043657 2:109169462-109169484 TTGTCGGGGAGGAAGCTGGAGGG + Intronic
936086249 2:109471489-109471511 GTGTCAAAGAGGGACCTGGAGGG - Intronic
936332623 2:111561542-111561564 GTGTTGAAGAGGTAGCTGGAAGG + Intergenic
936647530 2:114388972-114388994 ATGCCAAAGAGGCAGCTGGATGG + Intergenic
937305288 2:120867146-120867168 AAGAGGAAGAGGAAGCTGGGTGG - Intronic
937422799 2:121772563-121772585 ACGTGGCAGAGGAAGCTGAAGGG - Intergenic
937740705 2:125349586-125349608 ATGTTGGGGAGGAAGCTGGTGGG - Intergenic
941012902 2:160321332-160321354 AGGGAGAAGAGGAAGCTGAATGG - Intronic
943173213 2:184431688-184431710 ATGTAGAAGAGGAATCAGAATGG + Intergenic
943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG + Intergenic
943621706 2:190155516-190155538 AGGTCCTAGAGGAAGCTGAATGG + Intronic
943721372 2:191206507-191206529 ATTTCCCCGAGGAAGCTGGAAGG - Intergenic
943746049 2:191463711-191463733 ATGTAGAAGGGGTAGCTGGATGG - Intergenic
944389284 2:199200724-199200746 ATGTGGAGGAGGAAGCTGTTGGG - Intergenic
946006832 2:216532436-216532458 ATGTCAAAAAGGAAACTGGGTGG - Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947378129 2:229518077-229518099 ATCTCAAAGCAGAAGCTGGATGG + Intronic
948063483 2:235059290-235059312 AGGTCAAAGAGGAAGCTTGCAGG + Intergenic
1170053604 20:12174501-12174523 AGTTCTAAGAGGAAGCAGGAGGG - Intergenic
1170217679 20:13908873-13908895 ATGTACAAAGGGAAGCTGGATGG - Intronic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1173178883 20:40786614-40786636 ATGCAGAAGAGGCAGCAGGATGG - Intergenic
1173571394 20:44078976-44078998 AGGAGTAAGAGGAAGCTGGAAGG - Intergenic
1173747281 20:45447627-45447649 ATGTTGAAGAAGGACCTGGAAGG - Intergenic
1174708015 20:52676803-52676825 AAGCCCAATAGGAAGCTGGAGGG - Intergenic
1178514372 21:33233920-33233942 AAGTCAGAGAGGAAGATGGAAGG + Intronic
1178827591 21:36029648-36029670 ATGTCACAGAGGAAGCAGGTTGG - Intergenic
1178942591 21:36918943-36918965 ATGTCTAATTGGAAACTGGAAGG + Intronic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1182655231 22:31884748-31884770 ATGTCAAGTAGGTAGCTGGAGGG - Intronic
949131256 3:503699-503721 ATGTCCAAGAGGAAGCATTAAGG - Intergenic
954455688 3:50598567-50598589 ATGGTGAAGTGGGAGCTGGAGGG + Intergenic
956463737 3:69498055-69498077 ATGCTGCCGAGGAAGCTGGATGG + Intronic
958049279 3:88323739-88323761 GTGTCGAAGGGGAACCTGGTGGG + Intergenic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
964247445 3:154669905-154669927 ATGTTGAAGAGGCAGCAGGATGG + Intergenic
964655679 3:159063910-159063932 ACTTGGAAGAGGAAGCTAGATGG - Intronic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
967315466 3:188148607-188148629 ATGAGGAAGGGGAAGCTGCAGGG + Intergenic
967493148 3:190116231-190116253 ATGTAGAAGAGGAAGAGGAAAGG + Intronic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
967881670 3:194306013-194306035 ATGTTTAAGAGGAGGCTGGCGGG + Intergenic
970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG + Intergenic
975273486 4:72466265-72466287 ATGTAGAAGAAGAGGCTAGAGGG + Intronic
977405195 4:96588965-96588987 ATGTCGAACAAGAAGTTTGAAGG - Intergenic
979268608 4:118732689-118732711 ATTTCCCAGAGGAGGCTGGAAGG - Intronic
979846715 4:125522846-125522868 AAGTCGAAGAAGCAGCTGGACGG + Intergenic
979858392 4:125663313-125663335 ATGTATAAGAGCAAGCTGTAAGG + Intergenic
979981331 4:127258885-127258907 AGTTCAAAGAGGAAGCAGGAGGG - Intergenic
980490417 4:133518327-133518349 ATGTCTAAGACAAAGATGGATGG + Intergenic
981055886 4:140360929-140360951 ATGTCGCAGAAGGTGCTGGATGG - Intronic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981747250 4:148063702-148063724 AGGTGGAAGAGGCTGCTGGAGGG - Intronic
983893091 4:173051432-173051454 ATGTCCTAGAGGAAGCAGCAGGG + Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
985667770 5:1191131-1191153 AGGTGGAAGAGGAAGCTCCAGGG + Intergenic
986680820 5:10231479-10231501 AGGTCAGAGAGGAAGCAGGATGG - Intronic
988494148 5:31730474-31730496 ATGGCGGAGTGGAGGCTGGAGGG - Intronic
990631091 5:57670019-57670041 ATGTCGAGGAGGGAGCTGGTGGG - Intergenic
991258588 5:64642598-64642620 CAGTTGAAGAGGAATCTGGAAGG - Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
992643830 5:78793836-78793858 ATGTCTCAGATGAAACTGGAAGG + Intronic
993052308 5:82939858-82939880 AGGTAGAAGAGGGAGATGGAGGG - Intergenic
994999025 5:107103439-107103461 ACGTCGAAGAGGCAGCTAGATGG + Intergenic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000975366 5:167758489-167758511 ATGACAAGGAGGAAGCTGGTAGG - Intronic
1001455941 5:171859664-171859686 ATGTCTAAGTTGAAGCTGCAAGG + Intergenic
1003714496 6:8631536-8631558 ATGCTGAAGTGGAAACTGGAAGG - Intergenic
1005765403 6:29006321-29006343 AAGACGAAGAGGAGGATGGAAGG - Intergenic
1005801075 6:29425685-29425707 ATGTTGATGTTGAAGCTGGATGG + Exonic
1006311878 6:33266847-33266869 CTGTCTAAGAGCAAGCTGAATGG + Intronic
1007980318 6:46148401-46148423 TTGTGGAAGAGGCAGCTGAAAGG + Intergenic
1009562072 6:65258949-65258971 ATGTGGAAATGCAAGCTGGAGGG + Intronic
1010179189 6:73065461-73065483 ATGTCAGAGAGGAAGCTGGAAGG - Intronic
1013912216 6:115289711-115289733 AGGTCGAGGAAGAAGCTGGAAGG - Intergenic
1015407914 6:132857828-132857850 ATGATGCAGAGGAAGCTGGTGGG + Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1022749157 7:33205096-33205118 ATTTCTAAGAGGAAACTAGATGG - Intronic
1023337278 7:39183562-39183584 ATGTGGAAGAGGGACCTGGTGGG - Intronic
1023807536 7:43884267-43884289 AGGTGGAAGAGGAAGCAGCAGGG + Intronic
1028761125 7:94497428-94497450 ATATCAAAGAGGCAGCTGGACGG - Intergenic
1029837135 7:103324692-103324714 AACTCGAAGATGGAGCTGGAAGG + Intronic
1031633829 7:124077817-124077839 ATGTCGAGGAGGGACCTGGTGGG + Intergenic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1035377171 7:158413129-158413151 ATGTTGAGGAGGGCGCTGGATGG - Intronic
1036036978 8:5030240-5030262 TTGTTCAAGAGGAAGCTGGAGGG + Intergenic
1036968624 8:13328995-13329017 GAGTTGAAGAGGAAGCTGGAGGG + Intronic
1037387566 8:18359907-18359929 AGGCAGAAGAGGAAGATGGAAGG - Intergenic
1038389327 8:27180427-27180449 ATGATGAAGAGGGAGCTTGAGGG - Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043563694 8:81524061-81524083 ATGACGAAGAGGACAATGGAAGG - Intergenic
1043678789 8:82996094-82996116 ATGTCACAAATGAAGCTGGAAGG + Intergenic
1043813584 8:84773764-84773786 ATATAGAAAAGGAAGCTAGAAGG - Intronic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1044737596 8:95295033-95295055 AGGACGCTGAGGAAGCTGGATGG + Intergenic
1049346333 8:142141082-142141104 AGGAGGAAGAGGAAGCAGGAGGG - Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1051553265 9:18354562-18354584 CTTTTGAAGAGGAATCTGGAAGG + Intergenic
1059639209 9:116200117-116200139 TTGAGGAAGATGAAGCTGGAGGG - Intronic
1060110950 9:120905830-120905852 ATGTCCATCAGGAAGCTGAATGG + Intronic
1061818909 9:133212577-133212599 AGGTCAAAGAGGAAGCCTGAAGG + Intergenic
1061970992 9:134045408-134045430 GTGTTGCAGAGGAAGATGGATGG - Exonic
1062683689 9:137799041-137799063 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1062683708 9:137799121-137799143 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1186360707 X:8837919-8837941 ATCACAAAGAGAAAGCTGGAGGG - Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1191832748 X:65432504-65432526 ATGTGGAAGAGAAACTTGGAGGG + Intronic
1194802715 X:98291978-98292000 ACGTTGAAGAGGCAGCTGGGCGG - Intergenic
1198213175 X:134533790-134533812 AGGTAGAAGAGGAAGATGGAAGG + Intergenic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic