ID: 960396070

View in Genome Browser
Species Human (GRCh38)
Location 3:117139071-117139093
Sequence ATGGTTATCTATAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960396070 Original CRISPR ATGGTTATCTATAGGCAGGA GGG Intronic
901623880 1:10612400-10612422 AGTGTCATCTTTAGGCAGGAAGG - Intronic
901843433 1:11967221-11967243 ATGGGTATCTGCAGGCAGGTAGG + Intronic
905096469 1:35475810-35475832 ATGGTTCTCTAATGGCAGGTTGG - Intronic
908522236 1:64955610-64955632 ATTGTTTTCTATAGGCAATAGGG + Intronic
909948378 1:81689744-81689766 AGGGTCATCAAAAGGCAGGAAGG + Intronic
910268597 1:85368124-85368146 ACTGTCTTCTATAGGCAGGATGG - Intronic
910734722 1:90440902-90440924 ATATTCATCTATAGGCAAGAAGG - Intergenic
912783400 1:112574762-112574784 GTGGTTACCTTTAGGTAGGAAGG + Intronic
913055735 1:115157692-115157714 ATGGTTACCTCTAAGAAGGAAGG - Intergenic
913134321 1:115873317-115873339 ACAGTTATCTATATGGAGGATGG + Intergenic
916665207 1:166960639-166960661 ATGGTTATCAAGATTCAGGATGG - Intronic
917038368 1:170774482-170774504 ATGTTTAACAACAGGCAGGAAGG + Intergenic
917168586 1:172143657-172143679 ATTGTAAGCTATAGGCAAGAGGG + Intronic
917757414 1:178116144-178116166 AAGGTTATTTCTAGTCAGGAGGG - Intronic
917777829 1:178356706-178356728 GTGGTTATCTATAGGGTGAAAGG + Intronic
919105140 1:193140269-193140291 CTGGTTATTTAAAGGCTGGAGGG + Intronic
920928752 1:210367379-210367401 ATGGCTATCTAGAGGCACGTAGG - Intronic
922047295 1:221958441-221958463 GTGGTTATCTCTAGTCAGCAGGG - Intergenic
922145801 1:222943017-222943039 TTGGTTGTCTAAAGGCAGAAAGG - Exonic
922882140 1:228989161-228989183 ATGGTTATCTAAATGTTGGATGG + Intergenic
1066228201 10:33405131-33405153 ATGGATATGTATAGCTAGGATGG + Intergenic
1069615041 10:69801660-69801682 GGGGTTATTTATAGGCAGGAAGG - Intergenic
1070184665 10:74049551-74049573 ATGGTTAGATGTAGGGAGGAAGG + Intronic
1072727253 10:97822175-97822197 ATGGAAAGCTAGAGGCAGGAAGG - Intergenic
1077659546 11:4055297-4055319 ATGGTTAGCTGGAGCCAGGAAGG - Intronic
1077785765 11:5382024-5382046 ATTGTTAACAATATGCAGGAAGG - Intronic
1078037997 11:7828043-7828065 ATGGGTATTTGTAGGTAGGAAGG + Intergenic
1082566723 11:54689071-54689093 ATGGATACCTATGGTCAGGAAGG + Intergenic
1084044686 11:66561834-66561856 CTGGTTATCAAAAGACAGGAAGG + Intronic
1086858203 11:91892299-91892321 ATAGTTCGCTATAGGCATGAAGG + Intergenic
1093638352 12:21497522-21497544 ATGGTTAATGATTGGCAGGATGG + Intronic
1095622079 12:44268892-44268914 ATGGCTATCTTAAGGGAGGAGGG - Intronic
1099405452 12:82255292-82255314 TTGGGTATCTCAAGGCAGGAGGG - Intronic
1101697687 12:107141679-107141701 ATGGAAAGATATAGGCAGGAAGG - Intergenic
1102369345 12:112369081-112369103 ATGTCTATATATAGGCAGGAGGG - Intronic
1105044950 12:132994994-132995016 GTGGTTCTCAATGGGCAGGAGGG - Intronic
1107277259 13:38690517-38690539 CTGGCTATCAACAGGCAGGATGG - Exonic
1110040413 13:70748999-70749021 ATAAGTATCTATTGGCAGGATGG + Intergenic
1114173072 14:20294017-20294039 AAGATGATCTATAGACAGGATGG + Intronic
1117251576 14:53944902-53944924 ATGGACAACTATATGCAGGATGG + Intergenic
1119004217 14:70908612-70908634 ACGGTTTTTTAGAGGCAGGAGGG - Intronic
1122404001 14:101487913-101487935 ATGGTTATTTGTAGGCAGTGTGG - Intergenic
1128979725 15:72177405-72177427 ATGGCTATCCATGGCCAGGAGGG - Intronic
1129670572 15:77605695-77605717 AGGGTCATCCAGAGGCAGGAGGG - Intergenic
1138517395 16:57543746-57543768 ATGGTCAGCTGTAGGGAGGAAGG + Intronic
1139845249 16:69916477-69916499 ATGGCTATTTGTAGGCTGGATGG + Intronic
1141269290 16:82524168-82524190 AAGGTTATATATAGGTAGGAGGG - Intergenic
1149408526 17:56379812-56379834 ATGGTTAACTAGAAGCAGAAGGG + Intronic
1151083857 17:71358957-71358979 AAGGTTACCTATGGGAAGGATGG + Intergenic
1153266318 18:3273454-3273476 ATGGTTATCTCTGGGAAGGAGGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154473297 18:14725498-14725520 TTGGTTCTCAATAGGCAGGGTGG - Intergenic
1156507885 18:37610024-37610046 ATGGGTATTTTTAGGAAGGAGGG + Intergenic
1159816297 18:73078007-73078029 ATGGTTTTTAATGGGCAGGAAGG - Intergenic
1160107738 18:75994224-75994246 ATGGTTAACCATAGACAGAATGG - Intergenic
1164761667 19:30732921-30732943 ATGGTTATCTATGGGATGCAAGG - Intergenic
1165291824 19:34891748-34891770 CGGGATATCTATAGGCAGCAAGG - Intergenic
1166407455 19:42531086-42531108 ATTGTTAACTATAGTCAGGCCGG - Intronic
927375814 2:22412343-22412365 ATGTGTATCTATAGGGTGGAAGG - Intergenic
927448052 2:23183186-23183208 ATGATTAAGTAGAGGCAGGAAGG - Intergenic
927736442 2:25526781-25526803 ATGGTTATCTATAGGGGAAAAGG + Intronic
929043437 2:37768859-37768881 ATGCCTGTCTATATGCAGGATGG + Intergenic
929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG + Intergenic
929794538 2:45048994-45049016 AAGGTTATCTAAAACCAGGACGG - Intergenic
931654722 2:64500589-64500611 ATGGTTCTCTAGAGACAGGCAGG + Intergenic
933169938 2:79114019-79114041 ATGGTTCTCTTTAGAGAGGAGGG + Intergenic
936369928 2:111895326-111895348 ATGGTAGACTAGAGGCAGGAGGG + Intergenic
939525324 2:143286978-143287000 ATGGCTATATATAGCCAGGTGGG + Intronic
940947084 2:159630022-159630044 ATGGTTACCTAAAAGGAGGAAGG + Intergenic
941606168 2:167599691-167599713 ATGTTTATCTAAAGTTAGGAAGG - Intergenic
943174540 2:184453496-184453518 AATGTTATATATAGTCAGGATGG + Intergenic
944794848 2:203172635-203172657 ATGGTTATCTAAAGACAAAAAGG - Intronic
946508621 2:220329387-220329409 CTGGATATCTATAGGCAGAATGG - Intergenic
1169182743 20:3584234-3584256 AAGGTTCTCAATAGGCAGCAAGG - Intronic
1169553263 20:6723244-6723266 ATGCCTATTTATAAGCAGGAAGG - Intergenic
1171450337 20:25231377-25231399 ATGAATATCTAAAGGCAGAATGG + Intergenic
1171450851 20:25235268-25235290 ATGAATATCTAAAGGCAGAATGG + Intergenic
1171470332 20:25365248-25365270 ATGCTTATCTGTGGGCATGATGG - Intronic
1173060987 20:39661014-39661036 ATGATGATCAATAGGCAGAAAGG - Intergenic
1203295590 22_KI270736v1_random:40301-40323 ATGCCTGTCTATATGCAGGACGG + Intergenic
952483112 3:33782134-33782156 ATAGTTGTCTCTAGGAAGGAGGG - Intergenic
953303461 3:41803205-41803227 AAGGTGATATAAAGGCAGGAAGG + Intronic
953814735 3:46145612-46145634 ATGGCTAGCTCTAGGAAGGATGG + Intergenic
956280338 3:67549538-67549560 GTGGTTATCTATAGGGAATAGGG + Intronic
956758396 3:72413433-72413455 ATGGGTATTGACAGGCAGGATGG - Intronic
957030402 3:75234544-75234566 ATGGTTACCTATATCCAGCATGG + Intergenic
957358846 3:79128009-79128031 ATTGTTATCTTTTGACAGGAAGG - Intronic
960396070 3:117139071-117139093 ATGGTTATCTATAGGCAGGAGGG + Intronic
960839669 3:121944315-121944337 AGAATTATCTATAGTCAGGAAGG + Intergenic
961603779 3:128078879-128078901 ATGGTTCTGGATAGGTAGGAAGG - Intronic
962416785 3:135190056-135190078 ATAGCTATCTAGAGGCAGTATGG + Intronic
963196308 3:142534234-142534256 ATGCACATCTATAGTCAGGAAGG + Intronic
964188187 3:153972356-153972378 ATGGTTATAATGAGGCAGGAAGG + Intergenic
965617021 3:170604287-170604309 ATGGCTATGTGTAGGCAGTAAGG + Intronic
970328204 4:14951059-14951081 ATTGTTATCTATAGGATGGATGG + Intergenic
973827244 4:54720616-54720638 ATGGTTATCTCTGGGTAGTAAGG - Intronic
974720501 4:65731921-65731943 AAGGTTCTCTAGAGGCAGGTGGG - Intergenic
975501340 4:75088499-75088521 GTGGTTTTCTTCAGGCAGGAAGG - Intergenic
976108403 4:81644063-81644085 GTGATTCTCTATAGGAAGGAAGG + Intronic
984633685 4:182088383-182088405 AGTGTTATCAAGAGGCAGGAAGG + Intergenic
988242499 5:28632161-28632183 ATGGTTTTCTGTTGGCATGAAGG + Intergenic
988586131 5:32509080-32509102 ATGGTGATCTAGAGGTAGTATGG + Intergenic
989701370 5:44269032-44269054 ATGTTTTTCTATATTCAGGAGGG - Intergenic
991336638 5:65555561-65555583 CTGGTTAACTACAGGCAGTAAGG + Intronic
991640456 5:68746566-68746588 ATGGTCATTTATAGGGAGAATGG + Intergenic
994727607 5:103454652-103454674 ATGTTTATCTATCCGCATGATGG + Intergenic
997138688 5:131354397-131354419 ATGGTTACCTCTAGGCCTGAGGG - Intronic
999623691 5:153497991-153498013 AGGGTTATCTATCTGCAGAAGGG + Intronic
1005146543 6:22697544-22697566 ATGGTTCCCTAAAGGCAGAATGG + Intergenic
1010559141 6:77326393-77326415 ATGGTCCGTTATAGGCAGGAAGG + Intergenic
1011851788 6:91638457-91638479 ATGGATAGCTAAAGGAAGGAAGG + Intergenic
1017866681 6:158450119-158450141 ATGGTTACAGCTAGGCAGGAAGG - Intronic
1017949772 6:159126873-159126895 ATGCTTTTCTCTAGGCAGAAAGG - Intergenic
1018700041 6:166419273-166419295 ATGGTTGCTTCTAGGCAGGAAGG - Intronic
1019991116 7:4691885-4691907 ATGGTTCTCTTTGGGCAGAATGG + Intronic
1022959679 7:35414655-35414677 CTGGTTTTCTGCAGGCAGGATGG - Intergenic
1023300404 7:38764435-38764457 ATTTTATTCTATAGGCAGGAGGG + Intronic
1023785761 7:43706056-43706078 ATGGCTATCTAGAGGCAGCTAGG - Intronic
1026407233 7:70079066-70079088 ATGGTTATCAATCTGCAGCAGGG - Intronic
1027473173 7:78597653-78597675 ATGGTTAGGTAAAAGCAGGAAGG - Intronic
1028886235 7:95937248-95937270 ATGGTTAACTATAGTCACTATGG - Intronic
1034151955 7:148924058-148924080 ATGGTAACCTATAGGAAGAAGGG - Intergenic
1039359641 8:36862159-36862181 ATAGTTAGCTATAGGTAGGTAGG + Intronic
1040425746 8:47284293-47284315 TTAGTTATCTGTAGGCAGGCAGG - Intronic
1044335416 8:90978288-90978310 ATAGTTATCCATGGGCAGGACGG + Intronic
1044734321 8:95263045-95263067 ATGGTTATCTTTGGGAAGGAAGG + Intronic
1046861507 8:119097109-119097131 ATGGTGATCTTTAGAAAGGAGGG + Intronic
1047449337 8:124949733-124949755 CTGGTTCTCTGTAGTCAGGAAGG - Intergenic
1050144660 9:2554229-2554251 GTGGTTATGTATGGGCAGTAGGG + Intergenic
1050342586 9:4655362-4655384 GTGGTTACCTATAGCTAGGAGGG + Intronic
1051146427 9:14032326-14032348 ATTTTTTTCTGTAGGCAGGAAGG - Intergenic
1051580993 9:18674338-18674360 ATGGATATCTATTTCCAGGAGGG - Intronic
1052446132 9:28563904-28563926 ATTGTTATGCATAGGTAGGAGGG - Intronic
1052676967 9:31639003-31639025 ATGTTCATCTATAGGATGGATGG + Intergenic
1052784641 9:32817244-32817266 ATGGTCACCTATTGGCTGGAAGG - Intergenic
1054715175 9:68550298-68550320 ATGGTTACCTTTAGGAGGGAGGG + Intergenic
1060529042 9:124337217-124337239 AGGGTTATCTCTGGGCAGCAGGG - Intronic
1187771160 X:22698195-22698217 ATGGTTACTTATAGGAAAGAAGG - Intergenic
1187786649 X:22895967-22895989 ATGGTAATCTTTGGGCAGGAAGG + Intergenic
1191624418 X:63254839-63254861 TTGCTTATTTTTAGGCAGGAAGG - Intergenic
1197791987 X:130264593-130264615 ATGGTTAGCTATAGAAATGAAGG + Intronic
1198657739 X:138933058-138933080 ATTTTTATCTAAAGGCAGCATGG - Intronic
1198657810 X:138933724-138933746 ATTTTTATCTAAAGGCAGCATGG - Intronic