ID: 960397703

View in Genome Browser
Species Human (GRCh38)
Location 3:117157146-117157168
Sequence AGGTGTAAATAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960397697_960397703 28 Left 960397697 3:117157095-117157117 CCTGCAGGGGTGAAGATGAATGG No data
Right 960397703 3:117157146-117157168 AGGTGTAAATAGATGGAGAAAGG No data
960397696_960397703 29 Left 960397696 3:117157094-117157116 CCCTGCAGGGGTGAAGATGAATG No data
Right 960397703 3:117157146-117157168 AGGTGTAAATAGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960397703 Original CRISPR AGGTGTAAATAGATGGAGAA AGG Intergenic
No off target data available for this crispr