ID: 960399573

View in Genome Browser
Species Human (GRCh38)
Location 3:117179951-117179973
Sequence CTTTCAAGATAGATCAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960399573_960399576 26 Left 960399573 3:117179951-117179973 CCCTGTTTGATCTATCTTGAAAG No data
Right 960399576 3:117180000-117180022 TACCATCTTGCCTGCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960399573 Original CRISPR CTTTCAAGATAGATCAAACA GGG (reversed) Intergenic
No off target data available for this crispr