ID: 960402140

View in Genome Browser
Species Human (GRCh38)
Location 3:117214082-117214104
Sequence TGGGGCCCACACTTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960402140_960402142 -9 Left 960402140 3:117214082-117214104 CCTTGCACCAAGTGTGGGCCCCA No data
Right 960402142 3:117214096-117214118 TGGGCCCCAAATATTGTAGATGG No data
960402140_960402146 -2 Left 960402140 3:117214082-117214104 CCTTGCACCAAGTGTGGGCCCCA No data
Right 960402146 3:117214103-117214125 CAAATATTGTAGATGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960402140 Original CRISPR TGGGGCCCACACTTGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr