ID: 960404029

View in Genome Browser
Species Human (GRCh38)
Location 3:117238062-117238084
Sequence AGGGACAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960404020_960404029 26 Left 960404020 3:117238013-117238035 CCCCATCAGCAGGTGCTTGGCAC No data
Right 960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG No data
960404021_960404029 25 Left 960404021 3:117238014-117238036 CCCATCAGCAGGTGCTTGGCACA No data
Right 960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG No data
960404022_960404029 24 Left 960404022 3:117238015-117238037 CCATCAGCAGGTGCTTGGCACAG No data
Right 960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960404029 Original CRISPR AGGGACAGCACAGTGATTGT GGG Intergenic
No off target data available for this crispr