ID: 960405439

View in Genome Browser
Species Human (GRCh38)
Location 3:117253681-117253703
Sequence AAGCCTCCTCCCTCCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960405439_960405446 19 Left 960405439 3:117253681-117253703 CCATGGCTGGAGGGAGGAGGCTT No data
Right 960405446 3:117253723-117253745 TTAACCCATTGTGTGGGGGTGGG No data
960405439_960405445 18 Left 960405439 3:117253681-117253703 CCATGGCTGGAGGGAGGAGGCTT No data
Right 960405445 3:117253722-117253744 GTTAACCCATTGTGTGGGGGTGG No data
960405439_960405444 15 Left 960405439 3:117253681-117253703 CCATGGCTGGAGGGAGGAGGCTT No data
Right 960405444 3:117253719-117253741 TGTGTTAACCCATTGTGTGGGGG No data
960405439_960405449 30 Left 960405439 3:117253681-117253703 CCATGGCTGGAGGGAGGAGGCTT No data
Right 960405449 3:117253734-117253756 TGTGGGGGTGGGATGAGTACTGG No data
960405439_960405442 13 Left 960405439 3:117253681-117253703 CCATGGCTGGAGGGAGGAGGCTT No data
Right 960405442 3:117253717-117253739 ACTGTGTTAACCCATTGTGTGGG No data
960405439_960405441 12 Left 960405439 3:117253681-117253703 CCATGGCTGGAGGGAGGAGGCTT No data
Right 960405441 3:117253716-117253738 AACTGTGTTAACCCATTGTGTGG No data
960405439_960405443 14 Left 960405439 3:117253681-117253703 CCATGGCTGGAGGGAGGAGGCTT No data
Right 960405443 3:117253718-117253740 CTGTGTTAACCCATTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960405439 Original CRISPR AAGCCTCCTCCCTCCAGCCA TGG (reversed) Intergenic
No off target data available for this crispr