ID: 960413283

View in Genome Browser
Species Human (GRCh38)
Location 3:117354290-117354312
Sequence GAGTGTTTCACCTACCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960413280_960413283 27 Left 960413280 3:117354240-117354262 CCTAAAAGTGAGTGAACTCTTAA No data
Right 960413283 3:117354290-117354312 GAGTGTTTCACCTACCTCACTGG No data
960413282_960413283 0 Left 960413282 3:117354267-117354289 CCTCATACAAATTCTTAGAGGAA No data
Right 960413283 3:117354290-117354312 GAGTGTTTCACCTACCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960413283 Original CRISPR GAGTGTTTCACCTACCTCAC TGG Intergenic
No off target data available for this crispr