ID: 960417221

View in Genome Browser
Species Human (GRCh38)
Location 3:117399322-117399344
Sequence AACCCCATGCTATTACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960417218_960417221 5 Left 960417218 3:117399294-117399316 CCTCTGCTTCCATAGCAGCCTTC No data
Right 960417221 3:117399322-117399344 AACCCCATGCTATTACCTGCTGG No data
960417219_960417221 -4 Left 960417219 3:117399303-117399325 CCATAGCAGCCTTCTTCTGAACC No data
Right 960417221 3:117399322-117399344 AACCCCATGCTATTACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960417221 Original CRISPR AACCCCATGCTATTACCTGC TGG Intergenic
No off target data available for this crispr