ID: 960431879

View in Genome Browser
Species Human (GRCh38)
Location 3:117579553-117579575
Sequence AAGGAGAAGAAGAAAGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960431875_960431879 15 Left 960431875 3:117579515-117579537 CCAGATGTTGTTCCTTTGGATAA No data
Right 960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG No data
960431874_960431879 16 Left 960431874 3:117579514-117579536 CCCAGATGTTGTTCCTTTGGATA No data
Right 960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG No data
960431876_960431879 3 Left 960431876 3:117579527-117579549 CCTTTGGATAAAAAAAAAAAAAA No data
Right 960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960431879 Original CRISPR AAGGAGAAGAAGAAAGAGGT CGG Intergenic
No off target data available for this crispr