ID: 960433187

View in Genome Browser
Species Human (GRCh38)
Location 3:117594973-117594995
Sequence GTATAGTTCTTAAGGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960433182_960433187 -6 Left 960433182 3:117594956-117594978 CCTGATGACTACATCAGGTATAG No data
Right 960433187 3:117594973-117594995 GTATAGTTCTTAAGGGAGGGTGG No data
960433180_960433187 10 Left 960433180 3:117594940-117594962 CCTTGGGAAAACTATACCTGATG No data
Right 960433187 3:117594973-117594995 GTATAGTTCTTAAGGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960433187 Original CRISPR GTATAGTTCTTAAGGGAGGG TGG Intergenic
No off target data available for this crispr