ID: 960435816 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:117625393-117625415 |
| Sequence | ATGAAAGAGCTCCCTAATTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 960435816_960435817 | 10 | Left | 960435816 | 3:117625393-117625415 | CCTCAATTAGGGAGCTCTTTCAT | No data | ||
| Right | 960435817 | 3:117625426-117625448 | TTTCTAAAAATGTTACTTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 960435816 | Original CRISPR | ATGAAAGAGCTCCCTAATTG AGG (reversed) | Intergenic | ||