ID: 960435816

View in Genome Browser
Species Human (GRCh38)
Location 3:117625393-117625415
Sequence ATGAAAGAGCTCCCTAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960435816_960435817 10 Left 960435816 3:117625393-117625415 CCTCAATTAGGGAGCTCTTTCAT No data
Right 960435817 3:117625426-117625448 TTTCTAAAAATGTTACTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960435816 Original CRISPR ATGAAAGAGCTCCCTAATTG AGG (reversed) Intergenic