ID: 960436388

View in Genome Browser
Species Human (GRCh38)
Location 3:117632227-117632249
Sequence AAGCATATGCTGCTTCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960436385_960436388 7 Left 960436385 3:117632197-117632219 CCTTGAAATCATTTCATTAGTCT No data
Right 960436388 3:117632227-117632249 AAGCATATGCTGCTTCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960436388 Original CRISPR AAGCATATGCTGCTTCTGAG GGG Intergenic
No off target data available for this crispr