ID: 960439601

View in Genome Browser
Species Human (GRCh38)
Location 3:117670498-117670520
Sequence CTGAGCCTGAAGAAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960439601_960439602 -3 Left 960439601 3:117670498-117670520 CCTGCACACTTCTTCAGGCTCAG No data
Right 960439602 3:117670518-117670540 CAGCTCAATTTCAGCCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960439601 Original CRISPR CTGAGCCTGAAGAAGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr