ID: 960444896

View in Genome Browser
Species Human (GRCh38)
Location 3:117735855-117735877
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960444896_960444904 23 Left 960444896 3:117735855-117735877 CCCATTCTAGTCCAGTCACACTG No data
Right 960444904 3:117735901-117735923 CCTTGACCACACACCAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960444896 Original CRISPR CAGTGTGACTGGACTAGAAT GGG (reversed) Intergenic
No off target data available for this crispr