ID: 960444904

View in Genome Browser
Species Human (GRCh38)
Location 3:117735901-117735923
Sequence CCTTGACCACACACCAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960444896_960444904 23 Left 960444896 3:117735855-117735877 CCCATTCTAGTCCAGTCACACTG No data
Right 960444904 3:117735901-117735923 CCTTGACCACACACCAATACAGG No data
960444900_960444904 -4 Left 960444900 3:117735882-117735904 CCTTCCTCTATGCCAAACTCCTT No data
Right 960444904 3:117735901-117735923 CCTTGACCACACACCAATACAGG No data
960444897_960444904 22 Left 960444897 3:117735856-117735878 CCATTCTAGTCCAGTCACACTGG No data
Right 960444904 3:117735901-117735923 CCTTGACCACACACCAATACAGG No data
960444901_960444904 -8 Left 960444901 3:117735886-117735908 CCTCTATGCCAAACTCCTTGACC No data
Right 960444904 3:117735901-117735923 CCTTGACCACACACCAATACAGG No data
960444899_960444904 12 Left 960444899 3:117735866-117735888 CCAGTCACACTGGCATCCTTCCT No data
Right 960444904 3:117735901-117735923 CCTTGACCACACACCAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960444904 Original CRISPR CCTTGACCACACACCAATAC AGG Intergenic
No off target data available for this crispr