ID: 960449318

View in Genome Browser
Species Human (GRCh38)
Location 3:117786997-117787019
Sequence ATGGGTAAAGTGATGTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960449318_960449323 1 Left 960449318 3:117786997-117787019 CCATGCAACATCACTTTACCCAT No data
Right 960449323 3:117787021-117787043 CTTTAGTGATTTTGTTGGTTGGG No data
960449318_960449322 0 Left 960449318 3:117786997-117787019 CCATGCAACATCACTTTACCCAT No data
Right 960449322 3:117787020-117787042 ACTTTAGTGATTTTGTTGGTTGG No data
960449318_960449324 15 Left 960449318 3:117786997-117787019 CCATGCAACATCACTTTACCCAT No data
Right 960449324 3:117787035-117787057 TTGGTTGGGCACATCTTGCCAGG No data
960449318_960449321 -4 Left 960449318 3:117786997-117787019 CCATGCAACATCACTTTACCCAT No data
Right 960449321 3:117787016-117787038 CCATACTTTAGTGATTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960449318 Original CRISPR ATGGGTAAAGTGATGTTGCA TGG (reversed) Intergenic
No off target data available for this crispr