ID: 960449321

View in Genome Browser
Species Human (GRCh38)
Location 3:117787016-117787038
Sequence CCATACTTTAGTGATTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960449315_960449321 30 Left 960449315 3:117786963-117786985 CCTGGCTTGTTCTTTGGAACTTT No data
Right 960449321 3:117787016-117787038 CCATACTTTAGTGATTTTGTTGG No data
960449318_960449321 -4 Left 960449318 3:117786997-117787019 CCATGCAACATCACTTTACCCAT No data
Right 960449321 3:117787016-117787038 CCATACTTTAGTGATTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960449321 Original CRISPR CCATACTTTAGTGATTTTGT TGG Intergenic
No off target data available for this crispr