ID: 960449322

View in Genome Browser
Species Human (GRCh38)
Location 3:117787020-117787042
Sequence ACTTTAGTGATTTTGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960449318_960449322 0 Left 960449318 3:117786997-117787019 CCATGCAACATCACTTTACCCAT No data
Right 960449322 3:117787020-117787042 ACTTTAGTGATTTTGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960449322 Original CRISPR ACTTTAGTGATTTTGTTGGT TGG Intergenic
No off target data available for this crispr