ID: 960449323

View in Genome Browser
Species Human (GRCh38)
Location 3:117787021-117787043
Sequence CTTTAGTGATTTTGTTGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960449318_960449323 1 Left 960449318 3:117786997-117787019 CCATGCAACATCACTTTACCCAT No data
Right 960449323 3:117787021-117787043 CTTTAGTGATTTTGTTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960449323 Original CRISPR CTTTAGTGATTTTGTTGGTT GGG Intergenic
No off target data available for this crispr