ID: 960449324

View in Genome Browser
Species Human (GRCh38)
Location 3:117787035-117787057
Sequence TTGGTTGGGCACATCTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960449320_960449324 -4 Left 960449320 3:117787016-117787038 CCATACTTTAGTGATTTTGTTGG No data
Right 960449324 3:117787035-117787057 TTGGTTGGGCACATCTTGCCAGG No data
960449319_960449324 -3 Left 960449319 3:117787015-117787037 CCCATACTTTAGTGATTTTGTTG No data
Right 960449324 3:117787035-117787057 TTGGTTGGGCACATCTTGCCAGG No data
960449318_960449324 15 Left 960449318 3:117786997-117787019 CCATGCAACATCACTTTACCCAT No data
Right 960449324 3:117787035-117787057 TTGGTTGGGCACATCTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960449324 Original CRISPR TTGGTTGGGCACATCTTGCC AGG Intergenic
No off target data available for this crispr