ID: 960449324 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:117787035-117787057 |
| Sequence | TTGGTTGGGCACATCTTGCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 960449320_960449324 | -4 | Left | 960449320 | 3:117787016-117787038 | CCATACTTTAGTGATTTTGTTGG | No data | ||
| Right | 960449324 | 3:117787035-117787057 | TTGGTTGGGCACATCTTGCCAGG | No data | ||||
| 960449319_960449324 | -3 | Left | 960449319 | 3:117787015-117787037 | CCCATACTTTAGTGATTTTGTTG | No data | ||
| Right | 960449324 | 3:117787035-117787057 | TTGGTTGGGCACATCTTGCCAGG | No data | ||||
| 960449318_960449324 | 15 | Left | 960449318 | 3:117786997-117787019 | CCATGCAACATCACTTTACCCAT | No data | ||
| Right | 960449324 | 3:117787035-117787057 | TTGGTTGGGCACATCTTGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 960449324 | Original CRISPR | TTGGTTGGGCACATCTTGCC AGG | Intergenic | ||
| No off target data available for this crispr | |||||