ID: 960452974

View in Genome Browser
Species Human (GRCh38)
Location 3:117832780-117832802
Sequence TAGCAGAGTTCAGCTTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960452971_960452974 -4 Left 960452971 3:117832761-117832783 CCATCTTTCCCAGGATGTGTAGC No data
Right 960452974 3:117832780-117832802 TAGCAGAGTTCAGCTTGTTCAGG No data
960452968_960452974 26 Left 960452968 3:117832731-117832753 CCACGCAATGTGGGAGAGGAGAA No data
Right 960452974 3:117832780-117832802 TAGCAGAGTTCAGCTTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960452974 Original CRISPR TAGCAGAGTTCAGCTTGTTC AGG Intergenic
No off target data available for this crispr