ID: 960460228

View in Genome Browser
Species Human (GRCh38)
Location 3:117925191-117925213
Sequence ACTAGGATAATGAACCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960460228_960460232 0 Left 960460228 3:117925191-117925213 CCCTCATGGTTCATTATCCTAGT No data
Right 960460232 3:117925214-117925236 CCTAATAGATTTGTTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960460228 Original CRISPR ACTAGGATAATGAACCATGA GGG (reversed) Intergenic
No off target data available for this crispr