ID: 960462139

View in Genome Browser
Species Human (GRCh38)
Location 3:117949202-117949224
Sequence AGATCTACCATGCAAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960462139_960462151 28 Left 960462139 3:117949202-117949224 CCCCCCATTTGCATGGTAGATCT No data
Right 960462151 3:117949253-117949275 GGGTGTCGTTACCTACGAGATGG No data
960462139_960462148 8 Left 960462139 3:117949202-117949224 CCCCCCATTTGCATGGTAGATCT No data
Right 960462148 3:117949233-117949255 CCTTTTAACTCTGACCCTATGGG No data
960462139_960462152 29 Left 960462139 3:117949202-117949224 CCCCCCATTTGCATGGTAGATCT No data
Right 960462152 3:117949254-117949276 GGTGTCGTTACCTACGAGATGGG No data
960462139_960462146 7 Left 960462139 3:117949202-117949224 CCCCCCATTTGCATGGTAGATCT No data
Right 960462146 3:117949232-117949254 CCCTTTTAACTCTGACCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960462139 Original CRISPR AGATCTACCATGCAAATGGG GGG (reversed) Intergenic
No off target data available for this crispr