ID: 960465935

View in Genome Browser
Species Human (GRCh38)
Location 3:117996886-117996908
Sequence TGCGCGCGCGCGTGTGAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465935_960465938 25 Left 960465935 3:117996886-117996908 CCCCGTTCACACGCGCGCGCGCA No data
Right 960465938 3:117996934-117996956 ACACACACACACACAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465935 Original CRISPR TGCGCGCGCGCGTGTGAACG GGG (reversed) Intergenic