ID: 960465961

View in Genome Browser
Species Human (GRCh38)
Location 3:117997059-117997081
Sequence GGGTTTATTTACAAGTCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465961_960465968 24 Left 960465961 3:117997059-117997081 CCGCAGGACTTGTAAATAAACCC No data
Right 960465968 3:117997106-117997128 TCTTACTCCACCGACCACCCCGG No data
960465961_960465962 -5 Left 960465961 3:117997059-117997081 CCGCAGGACTTGTAAATAAACCC No data
Right 960465962 3:117997077-117997099 AACCCTGTTCCATCCAGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465961 Original CRISPR GGGTTTATTTACAAGTCCTG CGG (reversed) Intergenic